RNA id: TU819443



Basic Information


Item Value
RNA id TU819443
length 449
lncRNA type read_through
GC content 0.46
exon number 4
gene id G721238
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52589219 ~ 52656589 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gttctgagagcgataaatgtcccacccagccaaagtcagccacacccttagtattccactcattgggtttctgtagtgtagtggttatcacgttcgcctaacatgcgaaaggtccccggttcgagaccgggcggaaacacattttaacaaattggtccttcgcacttctcagtatttgttattcagactttagtttcagtagtatgttggttatcacgttcgcctcacacgcgaaagtcagtcacacccttagttttccaatcattgggtttctgtagtgtagtggttatcacgttcgcctcacacgcgaaaggtccccggttcgaaaccgggcggaatcattttgtaatattcaatatttcccaatgcccagaggctagcatttggtttgaaacagttgaggtttgtctaaaccttgctgtctacctctccgacctgtggatcaatgt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819457 lncRNA downstream 43485 52540080 ~ 52545734 (-) True G721248
TU819441 lncRNA downstream 50880 52485609 ~ 52538339 (-) True G721237
TU819437 lncRNA downstream 98816 52483522 ~ 52490403 (-) True G721235
TU819408 lncRNA downstream 129560 52448814 ~ 52459659 (-) True G721207
TU819406 lncRNA downstream 132361 52448383 ~ 52456858 (-) False G721207
TU819473 lncRNA upstream 62697 52719286 ~ 52726784 (-) False G721260
TU819474 lncRNA upstream 64198 52720787 ~ 52726784 (-) False G721260
TU819472 lncRNA upstream 68359 52724948 ~ 52726784 (-) True G721260
TU819504 lncRNA upstream 121789 52778378 ~ 52778596 (-) True G721288
TU819505 lncRNA upstream 122447 52779036 ~ 52779473 (-) True G721289
trnav-aac-81 mRNA downstream 1126 52588021 ~ 52588093 (-) True trnav-aac-81
trnav-aac-80 mRNA downstream 2633 52586514 ~ 52586586 (-) True trnav-aac-80
trnav-aac-79 mRNA downstream 3915 52585232 ~ 52585304 (-) True trnav-aac-79
trnav-uac-13 mRNA downstream 4117 52585030 ~ 52585102 (-) True trnav-uac-13
trnav-aac-78 mRNA downstream 5197 52583950 ~ 52584022 (-) True trnav-aac-78
trnav-aac-129 mRNA upstream 1168 52657757 ~ 52657829 (-) True trnav-aac-129
trnav-cac-40 mRNA upstream 2474 52659063 ~ 52659135 (-) True trnav-cac-40
trnav-aac-130 mRNA upstream 2676 52659265 ~ 52659337 (-) True trnav-aac-130
trnav-cac-41 mRNA upstream 3982 52660571 ~ 52660643 (-) True trnav-cac-41
trnav-aac-131 mRNA upstream 4184 52660773 ~ 52660845 (-) True trnav-aac-131
TU817704 other downstream 1330200 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1649748 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2699967 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2751523 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 3800257 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 104450 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 806593 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 841559 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1146854 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1269639 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU819443 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU819443 Expression in each Bioproject

Bar chart with 5 bars.
TU819443 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.