RNA id: TU819472



Basic Information


Item Value
RNA id TU819472
length 252
lncRNA type sense_over
GC content 0.37
exon number 2
gene id G721260
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52719286 ~ 52726784 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gagccaggcaaattcatttatcagggtcattgtaatggatatatccaaagaaatggcaatataatccaaggtaaaacaaacaaaaatgtagatcgttttctgtcatttcagctgcttgatgtgattgtgtgatatatttagttggctggctagcaaaggaaaagaagctagcctgcataggtacagtgcattcggaaagttttcagaccccttacttttttccacattttgttacgttacagccttatacta

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819453 lncRNA downstream 56502 52533209 ~ 52668446 (-) True G721245
TU819443 lncRNA downstream 68359 52589219 ~ 52656589 (-) True G721238
TU819447 lncRNA downstream 124812 52503689 ~ 52600136 (-) True trnav-cac-22
TU819440 lncRNA downstream 132992 52484057 ~ 52591956 (-) True G721236
TU819504 lncRNA upstream 51594 52778378 ~ 52778596 (-) True G721288
TU819505 lncRNA upstream 52252 52779036 ~ 52779473 (-) True G721289
TU819478 lncRNA upstream 66533 52793317 ~ 52818700 (-) False selenof
TU819476 lncRNA upstream 66594 52793378 ~ 52818726 (-) False selenof
TU819477 lncRNA upstream 66594 52793378 ~ 52818700 (-) True selenof
trnav-aac-152 mRNA downstream 809 52724067 ~ 52724139 (-) True trnav-aac-152
trnav-cac-82 mRNA downstream 1011 52723865 ~ 52723937 (-) True trnav-cac-82
trnav-cac-81 mRNA downstream 2317 52722559 ~ 52722631 (-) True trnav-cac-81
trnav-cac-80 mRNA downstream 3623 52721253 ~ 52721325 (-) True trnav-cac-80
trnav-aac-151 mRNA downstream 4929 52719947 ~ 52720019 (-) True trnav-aac-151
trnav-cac-84 mRNA upstream 174 52726958 ~ 52727030 (-) True trnav-cac-84
trnav-cac-85 mRNA upstream 3114 52729898 ~ 52729970 (-) True trnav-cac-85
XM_021612885.2 mRNA upstream 6226 52733010 ~ 52756561 (-) False LOC110530084
XM_021612882.2 mRNA upstream 6226 52733010 ~ 52756595 (-) False LOC110530084
XM_021612883.2 mRNA upstream 6226 52733010 ~ 52756602 (-) False LOC110530084
TU817704 other downstream 1465929 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1785477 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2835696 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2887252 49785674 ~ 49837696 (-) True G718489
TU814229 other downstream 3935986 48788521 ~ 48788962 (-) True G716488
TU819491 other upstream 34255 52761039 ~ 52761451 (-) True G721275
TU820029 other upstream 736398 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 771364 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1076659 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1199444 53926228 ~ 53927959 (-) True G722670

Expression Profile


TU819472 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU819472 Expression in each Bioproject

Bar chart with 2 bars.
TU819472 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.