RNA id: TU819505



Basic Information


Item Value
RNA id TU819505
length 438
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G721289
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52779036 ~ 52779473 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctctggaccctgatctctcttttgaagaacatatcaagaccatttcaaggacagcttttttccatctatgtaacattgcaaaaatcaggaactttctgtccaaaaatgatgcagaaaaattaatccatgcttttgtcacttccaggttagactactgcaatgctctactttccggctacccggataaagcactaaataaacttcagttagtgctaaatacggctgctagaatcctgactagaaccaaaaatttttatcatattactccagtgctagcctctctacactggcttcctgtcaaagcaagggctgatttcaaggttttactgctaacctacaaagcattacatgggcttgctcctatctatctctctgatttggtcctgccgtacatacctacacgtacgctacggtcacaagacgcaggcctcctaattg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819504 lncRNA downstream 440 52778378 ~ 52778596 (-) True G721288
TU819473 lncRNA downstream 52252 52719286 ~ 52726784 (-) False G721260
TU819474 lncRNA downstream 52252 52720787 ~ 52726784 (-) False G721260
TU819472 lncRNA downstream 52252 52724948 ~ 52726784 (-) True G721260
TU819443 lncRNA downstream 122447 52589219 ~ 52656589 (-) True G721238
TU819478 lncRNA upstream 13844 52793317 ~ 52818700 (-) False selenof
TU819476 lncRNA upstream 13905 52793378 ~ 52818726 (-) False selenof
TU819477 lncRNA upstream 13905 52793378 ~ 52818700 (-) True selenof
TU819641 lncRNA upstream 195324 52974797 ~ 52977530 (-) True G721414
TU819652 lncRNA upstream 207444 52986917 ~ 52989556 (-) True G721425
XM_021612883.2 mRNA downstream 22434 52733010 ~ 52756602 (-) False LOC110530084
XM_021612884.2 mRNA downstream 22434 52733010 ~ 52756602 (-) True LOC110530084
XM_021612882.2 mRNA downstream 22441 52733010 ~ 52756595 (-) False LOC110530084
XM_021612885.2 mRNA downstream 22475 52733010 ~ 52756561 (-) False LOC110530084
trnav-cac-85 mRNA downstream 49066 52729898 ~ 52729970 (-) True trnav-cac-85
NM_001124454.4 mRNA upstream 14272 52793745 ~ 52818707 (-) False selenof
XM_021612892.2 mRNA upstream 126894 52906367 ~ 52917437 (-) True LOC110530090
XM_021612900.2 mRNA upstream 169528 52949001 ~ 52953245 (-) False LOC110530094
XM_036985651.1 mRNA upstream 169528 52949001 ~ 52967822 (-) False LOC110530094
XM_021612898.2 mRNA upstream 169528 52949001 ~ 52967823 (-) False LOC110530094
TU819491 other downstream 17585 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 1520017 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 1839565 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 2889784 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 2941340 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 683709 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 718675 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 1023970 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 1146755 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 1344906 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU819505 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU819505 Expression in each Bioproject

Bar chart with 18 bars.
TU819505 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.