RNA id: TU819652



Basic Information


Item Value
RNA id TU819652
length 556
lncRNA type antisense_over
GC content 0.42
exon number 4
gene id G721425
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 52986917 ~ 52989556 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CCTGATGAACTGTATGTTTTGGATGTGGAAAAAGAGTGTATGTACCTACAAGCAGCAGGCGTATAAGAAAAGTGCTGAATGTTCGTAGCCCCAGTCCTACCACTCATTCTCATTTTGAGGCGTTTGACTGGAGTCTCCGTCAGTGTATCACTCCTGGTCTTCAGGTCTTGGAGGTAGGAGGAGAAACTCGAATGCTGATTCATAGGTCTCTTCAGAACCACCGGCACTCCATTTTGACAGCAGTCGTGGCCACACTGATCCTTGTTTTTGCAGAAGTGGTTACATTGTCTTTTGCCTGGAACTCTTTGGTCCAGAGTAGAAGGCACTAAACTTCTGCTGAATGTCCAACCCCACTGCAGAGAGGAAGATCTCAGAGTAGTTAATAGAAGGAGGTGTATATTCTTACTTTTTACAATTATCACTGAAACAATTTAATTAGACTTAAACTGCCTTTTAGAAGTTTTATGTAGTTTGTACAAGTGTATTTTGAACAATGACAAACGTAAAATCCTGACAGTTAACTGCCTGACCGTATTCTGAGCTGATTAGATTCACG

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU819641 lncRNA downstream 9387 52974797 ~ 52977530 (-) True G721414
TU819476 lncRNA downstream 168191 52793378 ~ 52818726 (-) False selenof
TU819478 lncRNA downstream 168217 52793317 ~ 52818700 (-) False selenof
TU819477 lncRNA downstream 168217 52793378 ~ 52818700 (-) True selenof
TU819505 lncRNA downstream 207444 52779036 ~ 52779473 (-) True G721289
TU819663 lncRNA upstream 19133 53008689 ~ 53010120 (-) True G721435
TU819632 lncRNA upstream 25062 53014618 ~ 53100336 (-) False G721407
TU819631 lncRNA upstream 87876 53077432 ~ 53080513 (-) False G721407
TU819633 lncRNA upstream 87876 53077432 ~ 53100336 (-) True G721407
TU819740 lncRNA upstream 134818 53124374 ~ 53124686 (-) True G721509
XM_021612898.2 mRNA downstream 19094 52949001 ~ 52967823 (-) False LOC110530094
XM_021612899.2 mRNA downstream 19094 52949001 ~ 52967823 (-) True LOC110530094
XM_036985651.1 mRNA downstream 19095 52949001 ~ 52967822 (-) False LOC110530094
XM_021612900.2 mRNA downstream 33672 52949001 ~ 52953245 (-) False LOC110530094
XM_021612892.2 mRNA downstream 69480 52906367 ~ 52917437 (-) True LOC110530090
XR_005052899.1 mRNA upstream 10043 52999599 ~ 53001669 (-) True LOC110530097
XM_021612908.2 mRNA upstream 25622 53015178 ~ 53018104 (-) True LOC110530096
XM_021611261.2 mRNA upstream 29950 53019506 ~ 53022146 (-) True LOC110529119
XM_021612915.2 mRNA upstream 70090 53059646 ~ 53067786 (-) True dipk1aa
XM_036985655.1 mRNA upstream 265641 53255197 ~ 53257589 (-) False LOC110530106
TU819491 other downstream 225466 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 1727898 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 2047446 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 3097665 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 3149221 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 473626 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 508592 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 813887 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 936672 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 1134823 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU819652 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU819652 Expression in each Bioproject

Bar chart with 15 bars.
TU819652 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 14.
End of interactive chart.