RNA id: TU819746



Basic Information


Item Value
RNA id TU819746
length 295
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G721515
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53152677 ~ 53152971 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CAATTTAGCCACTTCATCTGCACACTCGTTCTGGAATGGGAAAGTCCCAATTAATGAACTTGATGTATCCTACTGAAGATTAAAAGCTACAATATCAAATACTTTCAAGCTTTCAACCTATTAAAAGGCACTCAGCATATTTATTTTACCAGAATGCCTTACCTACACAGGCCTGCCATGTGGGTCACTCACTCATATATATATAGGCCTACCCTATAGGCTTATTCCTCTCTTGCAGAAAAACAGAAAGCTTTCAGCTCTTTGTTTCTCTATGAACCTTTCTCAGTTTCTCATG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819693 lncRNA downstream 545 53149493 ~ 53152132 (-) True G721464
TU819740 lncRNA downstream 27991 53124374 ~ 53124686 (-) True G721509
TU819632 lncRNA downstream 52341 53014618 ~ 53100336 (-) False G721407
TU819633 lncRNA downstream 52341 53077432 ~ 53100336 (-) True G721407
TU819631 lncRNA downstream 72164 53077432 ~ 53080513 (-) False G721407
TU819747 lncRNA upstream 152 53153123 ~ 53153362 (-) True G721516
TU819703 lncRNA upstream 30751 53183722 ~ 53184178 (-) True G721472
TU819756 lncRNA upstream 33696 53186667 ~ 53187007 (-) True G721525
TU819757 lncRNA upstream 35611 53188582 ~ 53188815 (-) True G721526
TU819831 lncRNA upstream 143138 53296109 ~ 53296328 (-) True G721599
XM_021612915.2 mRNA downstream 84891 53059646 ~ 53067786 (-) True dipk1aa
XM_021611261.2 mRNA downstream 130531 53019506 ~ 53022146 (-) True LOC110529119
XM_021612908.2 mRNA downstream 134573 53015178 ~ 53018104 (-) True LOC110530096
XR_005052899.1 mRNA downstream 151008 52999599 ~ 53001669 (-) True LOC110530097
XM_021612899.2 mRNA downstream 184854 52949001 ~ 52967823 (-) True LOC110530094
XM_036985655.1 mRNA upstream 102226 53255197 ~ 53257589 (-) False LOC110530106
XM_021612923.2 mRNA upstream 102226 53255197 ~ 53257830 (-) False LOC110530106
XM_036985654.1 mRNA upstream 102226 53255197 ~ 53258515 (-) True LOC110530106
XM_036985657.1 mRNA upstream 189632 53342603 ~ 53360245 (-) True nsun4
XM_021611263.2 mRNA upstream 309063 53462034 ~ 53478913 (-) False LOC110529122
TU819491 other downstream 391226 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 1893658 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 2213206 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 3263425 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 3314981 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 310211 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 345177 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 650472 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 773257 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 971408 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU819746 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

TU819746 Expression in each Bioproject

Bar chart with 11 bars.
TU819746 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.