RNA id: TU819918



Basic Information


Item Value
RNA id TU819918
length 218
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G721685
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53376030 ~ 53376247 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ACACACATGAGGTTTAGGGCTGTCTATTTTAAGGTTGTAATTGCAATGGCATTTTGGACATTTCTTGTTAATGTCACAACTGCTTACAGATTTACAGGCCTTGGGGTGCCATGTTTCAATTTTGTGTTTTTCGTAACAGTAGGCAGAACGACATGTGCGGTGACAATTCGCACAGGGTGTCAGGTTTAAGGGCTGCATCGGACAATTTTCATCCAGAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819870 lncRNA downstream 35068 53340741 ~ 53340962 (-) True G721638
TU819863 lncRNA downstream 45034 53330465 ~ 53330996 (-) True G721631
TU819831 lncRNA downstream 79702 53296109 ~ 53296328 (-) True G721599
TU819757 lncRNA downstream 187215 53188582 ~ 53188815 (-) True G721526
TU819756 lncRNA downstream 189023 53186667 ~ 53187007 (-) True G721525
TU819940 lncRNA upstream 11228 53387475 ~ 53387680 (-) True G721704
TU819983 lncRNA upstream 54456 53430703 ~ 53430952 (-) True G721747
TU820002 lncRNA upstream 67545 53443792 ~ 53444085 (-) True G721766
TU820019 lncRNA upstream 81575 53457822 ~ 53458026 (-) True G721782
TU820028 lncRNA upstream 86176 53462423 ~ 53462852 (-) False LOC110529122
XM_036985657.1 mRNA downstream 15785 53342603 ~ 53360245 (-) True nsun4
XM_036985654.1 mRNA downstream 117515 53255197 ~ 53258515 (-) True LOC110530106
XM_021612923.2 mRNA downstream 118200 53255197 ~ 53257830 (-) False LOC110530106
XM_036985655.1 mRNA downstream 118441 53255197 ~ 53257589 (-) False LOC110530106
XM_021612915.2 mRNA downstream 308244 53059646 ~ 53067786 (-) True dipk1aa
XM_021611263.2 mRNA upstream 85787 53462034 ~ 53478913 (-) False LOC110529122
XM_036985658.1 mRNA upstream 85787 53462034 ~ 53478913 (-) False LOC110529122
XM_021612937.2 mRNA upstream 124209 53500456 ~ 53569137 (-) False LOC110530111
XM_021612934.2 mRNA upstream 124209 53500456 ~ 53569139 (-) False LOC110530111
XM_021612935.2 mRNA upstream 124209 53500456 ~ 53585618 (-) False LOC110530111
TU819491 other downstream 614579 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 2117011 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 2436559 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 3486778 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 3538334 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 86935 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 121901 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 427196 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 549981 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 748132 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU819918 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU819918 Expression in each Bioproject

Bar chart with 13 bars.
TU819918 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.