RNA id: TU819983



Basic Information


Item Value
RNA id TU819983
length 250
lncRNA type inter_gene
GC content 0.47
exon number 1
gene id G721747
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53430703 ~ 53430952 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aagttcaccagtccctcctgcagcaaagcacccccacaacacgatgttgccacccccgtgtttcacggttgggatggtgttcttcagcttgcaagcctccccccttttcctccaaacataacaatggtcattatggccaaacagttctatttttgtttcatcagaccagaggacatttctccaaaaagtacgatctttgtcgccatgtgcagttgcaaaccgtattctggcttttttatggcgtttttgg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU819940 lncRNA downstream 43023 53387475 ~ 53387680 (-) True G721704
TU819918 lncRNA downstream 54456 53376030 ~ 53376247 (-) True G721685
TU819870 lncRNA downstream 89741 53340741 ~ 53340962 (-) True G721638
TU819863 lncRNA downstream 99707 53330465 ~ 53330996 (-) True G721631
TU819831 lncRNA downstream 134375 53296109 ~ 53296328 (-) True G721599
TU820002 lncRNA upstream 12840 53443792 ~ 53444085 (-) True G721766
TU820019 lncRNA upstream 26870 53457822 ~ 53458026 (-) True G721782
TU820028 lncRNA upstream 31471 53462423 ~ 53462852 (-) False LOC110529122
TU820041 lncRNA upstream 32848 53463800 ~ 53477483 (-) True LOC110529122
TU820062 lncRNA upstream 49941 53480893 ~ 53481125 (-) True G721825
XM_036985657.1 mRNA downstream 70458 53342603 ~ 53360245 (-) True nsun4
XM_036985654.1 mRNA downstream 172188 53255197 ~ 53258515 (-) True LOC110530106
XM_021612923.2 mRNA downstream 172873 53255197 ~ 53257830 (-) False LOC110530106
XM_036985655.1 mRNA downstream 173114 53255197 ~ 53257589 (-) False LOC110530106
XM_021612915.2 mRNA downstream 362917 53059646 ~ 53067786 (-) True dipk1aa
XM_021611263.2 mRNA upstream 31082 53462034 ~ 53478913 (-) False LOC110529122
XM_036985658.1 mRNA upstream 31082 53462034 ~ 53478913 (-) False LOC110529122
XM_021612937.2 mRNA upstream 69504 53500456 ~ 53569137 (-) False LOC110530111
XM_021612934.2 mRNA upstream 69504 53500456 ~ 53569139 (-) False LOC110530111
XM_021612935.2 mRNA upstream 69504 53500456 ~ 53585618 (-) False LOC110530111
TU819491 other downstream 669252 52761039 ~ 52761451 (-) True G721275
TU817704 other downstream 2171684 51252355 ~ 51259019 (-) True LOC110530043
TU817090 other downstream 2491232 50936928 ~ 50939471 (-) True G719151
TU816422 other downstream 3541451 49866630 ~ 49889252 (-) False LOC110530011
TU816366 other downstream 3593007 49785674 ~ 49837696 (-) True G718489
TU820029 other upstream 32230 53463182 ~ 53463764 (-) False LOC110529122
TU820769 other upstream 67196 53498148 ~ 53499730 (-) True G722459
TU820950 other upstream 372491 53803443 ~ 53856065 (-) True G722602
TU821019 other upstream 495276 53926228 ~ 53927959 (-) True G722670
TU821119 other upstream 693427 54124379 ~ 54139341 (-) True G722761

Expression Profile


TU819983 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU819983 Expression in each Bioproject

Bar chart with 21 bars.
TU819983 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.