RNA id: TU821043



Basic Information


Item Value
RNA id TU821043
length 206
lncRNA type inter_gene
GC content 0.35
exon number 1
gene id G722694
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 53952195 ~ 53952400 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ATATTGGAGTGGTTTATTGGGGGTGTGGCTTTCAGTTAGTTTTTATTAGTGAATTCCTGTCAAGTTCATGTGTCATGTTATATTTCATCAATTCTGACTAACGCAGTGCACTGGTTGCTATGAATTCTATCTGATGGTGTTTGCATGTTTAATTGAAAACACATAACGTCCTATTTGGAACATAACTTCTCTATTTTATTGGGTGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821035 lncRNA downstream 7249 53944594 ~ 53944946 (-) True G722686
TU821007 lncRNA downstream 46733 53905148 ~ 53905462 (-) True G722659
TU820960 lncRNA downstream 123136 53828679 ~ 53829059 (-) True G722612
TU820885 lncRNA downstream 123714 53825024 ~ 53828481 (-) True LOC110530934
TU820815 lncRNA downstream 242828 53635849 ~ 53709367 (-) True LOC110530114
TU821045 lncRNA upstream 1797 53954197 ~ 53954429 (-) True G722696
TU821055 lncRNA upstream 12776 53965176 ~ 53965407 (-) True G722699
TU821086 lncRNA upstream 80891 54033291 ~ 54034722 (-) True G722728
TU821166 lncRNA upstream 228042 54180442 ~ 54185532 (-) True G722805
TU821173 lncRNA upstream 235669 54188069 ~ 54189214 (-) True G722812
XM_021614230.2 mRNA downstream 34578 53914820 ~ 53917617 (-) True insl3
XM_036985677.1 mRNA downstream 71410 53825024 ~ 53880785 (-) False LOC110530934
XM_036985676.1 mRNA downstream 71412 53825024 ~ 53880783 (-) False LOC110530934
XM_036985672.1 mRNA downstream 71414 53818706 ~ 53880781 (-) False LOC110530934
XM_036985675.1 mRNA downstream 71416 53818706 ~ 53880779 (-) False LOC110530934
XM_036985678.1 mRNA upstream 13597 53965997 ~ 53995304 (-) False LOC110530121
XM_036985679.1 mRNA upstream 13597 53965997 ~ 53995304 (-) False LOC110530121
XM_036985680.1 mRNA upstream 29009 53981409 ~ 53995304 (-) True LOC110530121
XM_021612952.2 mRNA upstream 48729 54001129 ~ 54003188 (-) True LOC110530123
XR_005053060.1 mRNA upstream 50034 54002434 ~ 54002567 (-) True LOC118965682
TU821019 other downstream 24236 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 96130 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 452465 53498148 ~ 53499730 (-) True G722459
TU820029 other downstream 488431 53463182 ~ 53463764 (-) False LOC110529122
TU819491 other downstream 1190744 52761039 ~ 52761451 (-) True G721275
TU821119 other upstream 171979 54124379 ~ 54139341 (-) True G722761
TU821220 other upstream 298714 54251114 ~ 54251546 (-) True G722854
TU821231 other upstream 329285 54281685 ~ 54281978 (-) True G722864
TU822417 other upstream 1424881 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1444224 55396624 ~ 55396885 (-) True G723966

Expression Profile


TU821043 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU821043 Expression in each Bioproject

Bar chart with 9 bars.
TU821043 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.