RNA id: TU821119



Basic Information


Item Value
RNA id TU821119
length 855
RNA type TUCP
GC content 0.48
exon number 2
gene id G722761
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54124379 ~ 54139341 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


agaaaacgtttgacaaggttttcacacactgttgctggtattttggcccattcctccatgcagatctcctctagagcagtgatgtattggggctgttgctgggcaacacagactttcaactccctccaaagattttctatggggttgagatctggagactggctaggccactccaggaccttgaaatgcttcttacgaagccactccttcgttgcccgggcggtgtgtttgggatcattgtcatgctgaaagacccagccacgtttcatcttcaatgcccttgctgatggaaggaggttcactcaaaatctcacgatacatggccccattcattctttcctttacacggatcagtcgtcctggtccctttgcagaaaaacagccccaaagcatgatgtttccacccccatgcttcacagtaggtatggtgttctttggatgcaactcagcattctttgtcctccaaacacgacgagttttaccaaaaagttatattttggtttcatctgaccatatgacattctcccaatcttcttctggatcatccaaatgctctctagcaaacttcagatgggcctggacatgtctggcactgcaggatttgaggccctagcggcgtagtgtgttgtactgatggtaggctttgttactttggttccagctctctgcaggtcattcactaggtccccccgtgtggttctgggatttttgctcaccgttcttgtgatcattttgaccccacggggtgagatcttgcgtggagccccagatcgagggagattatcagtggtcttgtatgtcttccatttcctaataattgctcccacagttgatttcttcaaaccaaggtgacca

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821086 lncRNA downstream 89657 54033291 ~ 54034722 (-) True G722728
TU821055 lncRNA downstream 158972 53965176 ~ 53965407 (-) True G722699
TU821045 lncRNA downstream 169950 53954197 ~ 53954429 (-) True G722696
TU821043 lncRNA downstream 171979 53952195 ~ 53952400 (-) True G722694
TU821035 lncRNA downstream 179433 53944594 ~ 53944946 (-) True G722686
TU821166 lncRNA upstream 41101 54180442 ~ 54185532 (-) True G722805
TU821173 lncRNA upstream 48728 54188069 ~ 54189214 (-) True G722812
TU821176 lncRNA upstream 50051 54189392 ~ 54243058 (-) True G722814
TU821132 lncRNA upstream 65347 54204688 ~ 54207815 (-) True G722773
TU821215 lncRNA upstream 107731 54247072 ~ 54247859 (-) True G722849
XM_021612959.2 mRNA downstream 18969 54058122 ~ 54105410 (-) True LOC110530125
XM_021612953.2 mRNA downstream 84807 54024736 ~ 54039572 (-) True crsp7
XM_021612954.2 mRNA downstream 84808 54024736 ~ 54039571 (-) False crsp7
XM_036985681.1 mRNA downstream 109945 54008434 ~ 54014434 (-) True cnn2
XM_021612952.2 mRNA downstream 121191 54001129 ~ 54003188 (-) True LOC110530123
XM_021612975.2 mRNA upstream 234892 54374233 ~ 54377574 (-) True LOC110530134
XM_021612981.2 mRNA upstream 303789 54443130 ~ 54445222 (-) True LOC110530139
XM_021612982.2 mRNA upstream 306878 54446219 ~ 54465716 (-) True LOC110530140
XM_036985695.1 mRNA upstream 338584 54477925 ~ 54485433 (-) False LOC110530141
XM_021612983.2 mRNA upstream 338584 54477925 ~ 54485771 (-) False LOC110530141
TU821019 other downstream 196420 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 268314 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 624649 53498148 ~ 53499730 (-) True G722459
TU820029 other downstream 660615 53463182 ~ 53463764 (-) False LOC110529122
TU819491 other downstream 1362928 52761039 ~ 52761451 (-) True G721275
TU821220 other upstream 111773 54251114 ~ 54251546 (-) True G722854
TU821231 other upstream 142344 54281685 ~ 54281978 (-) True G722864
TU822417 other upstream 1237940 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1257283 55396624 ~ 55396885 (-) True G723966
TU822777 other upstream 1496197 55635538 ~ 55646014 (-) True G724287

Expression Profile


TU821119 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

TU821119 Expression in each Bioproject

Bar chart with 21 bars.
TU821119 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.