RNA id: TU821220



Basic Information


Item Value
RNA id TU821220
length 433
RNA type TUCP
GC content 0.42
exon number 1
gene id G722854
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54251114 ~ 54251546 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gattaaaccaaaattgaactttttggcaacaatgcaaaacattatgtttggcgtaaaagcaacacagcttaacacaccatccccactgtcaaacatggtggcggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagcaaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacttgagactgggacggagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctgcaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821215 lncRNA downstream 3255 54247072 ~ 54247859 (-) True G722849
TU821176 lncRNA downstream 8056 54189392 ~ 54243058 (-) True G722814
TU821132 lncRNA downstream 43299 54204688 ~ 54207815 (-) True G722773
TU821173 lncRNA downstream 61900 54188069 ~ 54189214 (-) True G722812
TU821166 lncRNA downstream 65582 54180442 ~ 54185532 (-) True G722805
TU821219 lncRNA upstream 599 54252145 ~ 54252842 (-) True G722853
TU821218 lncRNA upstream 2616 54254162 ~ 54254404 (-) True G722852
TU821227 lncRNA upstream 12193 54263739 ~ 54263859 (-) True G722860
TU821230 lncRNA upstream 21230 54272776 ~ 54273055 (-) True G722863
TU821229 lncRNA upstream 25223 54276769 ~ 54277039 (-) True G722862
XM_021612960.2 mRNA downstream 119375 54127068 ~ 54131739 (-) True LOC110530126
XM_021612959.2 mRNA downstream 145704 54058122 ~ 54105410 (-) True LOC110530125
XM_021612953.2 mRNA downstream 211542 54024736 ~ 54039572 (-) True crsp7
XM_021612954.2 mRNA downstream 211543 54024736 ~ 54039571 (-) False crsp7
XM_036985681.1 mRNA downstream 236680 54008434 ~ 54014434 (-) True cnn2
XM_021612975.2 mRNA upstream 122687 54374233 ~ 54377574 (-) True LOC110530134
XM_021612981.2 mRNA upstream 191584 54443130 ~ 54445222 (-) True LOC110530139
XM_021612982.2 mRNA upstream 194673 54446219 ~ 54465716 (-) True LOC110530140
XM_036985695.1 mRNA upstream 226379 54477925 ~ 54485433 (-) False LOC110530141
XM_021612983.2 mRNA upstream 226379 54477925 ~ 54485771 (-) False LOC110530141
TU821119 other downstream 111773 54124379 ~ 54139341 (-) True G722761
TU821019 other downstream 323155 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 395049 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 751384 53498148 ~ 53499730 (-) True G722459
TU820029 other downstream 787350 53463182 ~ 53463764 (-) False LOC110529122
TU821231 other upstream 30139 54281685 ~ 54281978 (-) True G722864
TU822417 other upstream 1125735 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1145078 55396624 ~ 55396885 (-) True G723966
TU822777 other upstream 1383992 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 1533971 55785517 ~ 55791485 (-) True G724400

Expression Profile


TU821220 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

TU821220 Expression in each Bioproject

Bar chart with 20 bars.
TU821220 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.