RNA id: TU821229



Basic Information


Item Value
RNA id TU821229
length 271
lncRNA type inter_gene
GC content 0.34
exon number 1
gene id G722862
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54276769 ~ 54277039 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TGTAGGTTCCTTTGTCTTAAATATATGAATGCCAAACTTAAAATGGTCCATCATGGTAATGGCTGATGTCCCTACAGAGTTTCAAGATGATAGGAAGTGTATTAACAGAATATTTAATTGGACATGTAAAATCTGATTGATCAATAACTCAGTCATCCCTTAACTAATCCTTTAGTTTGACAAAAGCTAAGATGCACAAACCAAGAGATGCACCATGGGCCTAACAAACATATGACATTTTTCAAAAGGTTTTTCCAAAATGTCCAAGATG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821230 lncRNA downstream 3714 54272776 ~ 54273055 (-) True G722863
TU821227 lncRNA downstream 12910 54263739 ~ 54263859 (-) True G722860
TU821218 lncRNA downstream 22365 54254162 ~ 54254404 (-) True G722852
TU821219 lncRNA downstream 23927 54252145 ~ 54252842 (-) True G722853
TU821215 lncRNA downstream 28910 54247072 ~ 54247859 (-) True G722849
TU821281 lncRNA upstream 53726 54330765 ~ 54331775 (-) True G722906
TU821332 lncRNA upstream 127576 54404615 ~ 54405913 (-) True G722949
TU821364 lncRNA upstream 191866 54468905 ~ 54469431 (-) True G722978
TU821376 lncRNA upstream 233124 54510163 ~ 54510508 (-) True G722990
TU821379 lncRNA upstream 236306 54513345 ~ 54514044 (-) True G722993
XM_021612960.2 mRNA downstream 145030 54127068 ~ 54131739 (-) True LOC110530126
XM_021612959.2 mRNA downstream 171359 54058122 ~ 54105410 (-) True LOC110530125
XM_021612953.2 mRNA downstream 237197 54024736 ~ 54039572 (-) True crsp7
XM_021612954.2 mRNA downstream 237198 54024736 ~ 54039571 (-) False crsp7
XM_036985681.1 mRNA downstream 262335 54008434 ~ 54014434 (-) True cnn2
XM_021612975.2 mRNA upstream 97194 54374233 ~ 54377574 (-) True LOC110530134
XM_021612981.2 mRNA upstream 166091 54443130 ~ 54445222 (-) True LOC110530139
XM_021612982.2 mRNA upstream 169180 54446219 ~ 54465716 (-) True LOC110530140
XM_036985695.1 mRNA upstream 200886 54477925 ~ 54485433 (-) False LOC110530141
XM_021612983.2 mRNA upstream 200886 54477925 ~ 54485771 (-) False LOC110530141
TU821220 other downstream 25223 54251114 ~ 54251546 (-) True G722854
TU821119 other downstream 137428 54124379 ~ 54139341 (-) True G722761
TU821019 other downstream 348810 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 420704 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 777039 53498148 ~ 53499730 (-) True G722459
TU821231 other upstream 4646 54281685 ~ 54281978 (-) True G722864
TU822417 other upstream 1100242 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1119585 55396624 ~ 55396885 (-) True G723966
TU822777 other upstream 1358499 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 1508478 55785517 ~ 55791485 (-) True G724400

Expression Profile


TU821229 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU821229 Expression in each Bioproject

Bar chart with 8 bars.
TU821229 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 35.
End of interactive chart.