RNA id: TU821231



Basic Information


Item Value
RNA id TU821231
length 294
RNA type TUCP
GC content 0.58
exon number 1
gene id G722864
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 54281685 ~ 54281978 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ccaggatggaacatcaatgcgagctgtggcaaggtttgctgtgtctgtcagcgtagtgtccagagcatggaggcgctaccaggagaaaggccagtacatcaggagacgtggaggaggccgtaggagggcaacaacccagcagcaggaccgctacctccgcctttgtgcaaggaggagcaggaggagcactgccagagccctgcaaaatgacctccagcaggccacaaatgtgcatgtgtctgctcaaacggtcagatacagactccatgagggtggtatgagggcccgacgtcc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU821229 lncRNA downstream 4646 54276769 ~ 54277039 (-) True G722862
TU821230 lncRNA downstream 8630 54272776 ~ 54273055 (-) True G722863
TU821227 lncRNA downstream 17826 54263739 ~ 54263859 (-) True G722860
TU821218 lncRNA downstream 27281 54254162 ~ 54254404 (-) True G722852
TU821219 lncRNA downstream 28843 54252145 ~ 54252842 (-) True G722853
TU821281 lncRNA upstream 48787 54330765 ~ 54331775 (-) True G722906
TU821332 lncRNA upstream 122637 54404615 ~ 54405913 (-) True G722949
TU821364 lncRNA upstream 186927 54468905 ~ 54469431 (-) True G722978
TU821376 lncRNA upstream 228185 54510163 ~ 54510508 (-) True G722990
TU821379 lncRNA upstream 231367 54513345 ~ 54514044 (-) True G722993
XM_021612960.2 mRNA downstream 149946 54127068 ~ 54131739 (-) True LOC110530126
XM_021612959.2 mRNA downstream 176275 54058122 ~ 54105410 (-) True LOC110530125
XM_021612953.2 mRNA downstream 242113 54024736 ~ 54039572 (-) True crsp7
XM_021612954.2 mRNA downstream 242114 54024736 ~ 54039571 (-) False crsp7
XM_036985681.1 mRNA downstream 267251 54008434 ~ 54014434 (-) True cnn2
XM_021612975.2 mRNA upstream 92255 54374233 ~ 54377574 (-) True LOC110530134
XM_021612981.2 mRNA upstream 161152 54443130 ~ 54445222 (-) True LOC110530139
XM_021612982.2 mRNA upstream 164241 54446219 ~ 54465716 (-) True LOC110530140
XM_036985695.1 mRNA upstream 195947 54477925 ~ 54485433 (-) False LOC110530141
XM_021612983.2 mRNA upstream 195947 54477925 ~ 54485771 (-) False LOC110530141
TU821220 other downstream 30139 54251114 ~ 54251546 (-) True G722854
TU821119 other downstream 142344 54124379 ~ 54139341 (-) True G722761
TU821019 other downstream 353726 53926228 ~ 53927959 (-) True G722670
TU820950 other downstream 425620 53803443 ~ 53856065 (-) True G722602
TU820769 other downstream 781955 53498148 ~ 53499730 (-) True G722459
TU822417 other upstream 1095303 55377281 ~ 55377776 (-) True G723955
TU822429 other upstream 1114646 55396624 ~ 55396885 (-) True G723966
TU822777 other upstream 1353560 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 1503539 55785517 ~ 55791485 (-) True G724400
TU823541 other upstream 1838225 56120203 ~ 56128288 (-) False G724943

Expression Profile


TU821231 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU821231 Expression in each Bioproject

Bar chart with 20 bars.
TU821231 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.