RNA id: TU822418



Basic Information


Item Value
RNA id TU822418
length 210
lncRNA type intronic
GC content 0.44
exon number 2
gene id G723956
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55378090 ~ 55378339 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TGTCTCTAGGCCTACACGGGTGATACACTTAGTAAATGTGTGTCTCTAGGCCTACACGGGTGATAAACTTAGTAAATGTGTGTCTCTAGGCCTACACAGGTGATGAACTTAGTAAATGTGTGTCTCTAGGCCTACACGGGTGATGAACTTAGTAAATGTGTGTCTCTAGGCCTACACGGGTGATGAACTTAGTAAATGTGTGTCTCTAGG

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU822347 lncRNA downstream 104187 55257662 ~ 55273903 (-) True G723891
TU822310 lncRNA downstream 157135 55218096 ~ 55220955 (-) True LOC110530159
TU822297 lncRNA downstream 191210 55186561 ~ 55186880 (-) True G723844
TU822296 lncRNA downstream 191963 55185627 ~ 55186127 (-) True G723843
TU822267 lncRNA downstream 237256 55139311 ~ 55140834 (-) True G723814
TU822430 lncRNA upstream 20710 55399049 ~ 55399513 (-) True G723967
TU822432 lncRNA upstream 24273 55402612 ~ 55403050 (-) True G723969
TU822433 lncRNA upstream 26205 55404544 ~ 55404942 (-) True G723970
TU822434 lncRNA upstream 26968 55405307 ~ 55405879 (-) True G723971
TU822449 lncRNA upstream 44715 55423054 ~ 55470008 (-) True G723979
XM_021613014.2 mRNA downstream 40492 55335612 ~ 55337598 (-) True LOC110530163
XM_021613016.2 mRNA downstream 40503 55335612 ~ 55337587 (-) False LOC110530163
XM_021613011.2 mRNA downstream 64486 55304680 ~ 55313604 (-) True LOC110530161
XR_005052911.1 mRNA downstream 154762 55217971 ~ 55223328 (-) False LOC110530159
XR_005052912.1 mRNA downstream 163357 55211750 ~ 55214733 (-) True LOC118965529
XM_036985719.1 mRNA upstream 45327 55423666 ~ 55456049 (-) False si:ch211-106h4.4
XM_036985720.1 mRNA upstream 49385 55427724 ~ 55456052 (-) True si:ch211-106h4.4
XM_036985721.1 mRNA upstream 82857 55461196 ~ 55468070 (-) True LOC110530166
XM_021613024.2 mRNA upstream 155277 55533616 ~ 55544134 (-) False odr4
XM_021613026.2 mRNA upstream 155281 55533620 ~ 55543988 (-) False odr4
TU822417 other downstream 314 55377281 ~ 55377776 (-) True G723955
TU821231 other downstream 1096112 54281685 ~ 54281978 (-) True G722864
TU821220 other downstream 1126544 54251114 ~ 54251546 (-) True G722854
TU821119 other downstream 1238749 54124379 ~ 54139341 (-) True G722761
TU821019 other downstream 1450131 53926228 ~ 53927959 (-) True G722670
TU822429 other upstream 18285 55396624 ~ 55396885 (-) True G723966
TU822777 other upstream 257199 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 407178 55785517 ~ 55791485 (-) True G724400
TU823541 other upstream 741864 56120203 ~ 56128288 (-) False G724943
TU823623 other upstream 841177 56219516 ~ 56232939 (-) True G725007

Expression Profile


TU822418 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU822418 Expression in each Bioproject

Bar chart with 6 bars.
TU822418 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.