RNA id: TU822429



Basic Information


Item Value
RNA id TU822429
length 262
RNA type TUCP
GC content 0.55
exon number 1
gene id G723966
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55396624 ~ 55396885 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctgggacactgtgaagtccatggagaacaagagcacctcctcccagctgcccactgcactgaggctaggtaacacggtcaccaccgataaatccatgattatcgaaaacttcaacaagcatttctcaatggctggccatgccttccgcctggctactccaacctcggccaacagctccgcccccccccgcagctactcgcccaagcctctccaggttctcctttacccaaatccagatagcagatgttctgaaagagctgc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU822418 lncRNA downstream 18285 55378090 ~ 55378339 (-) True G723956
TU822347 lncRNA downstream 122721 55257662 ~ 55273903 (-) True G723891
TU822310 lncRNA downstream 175669 55218096 ~ 55220955 (-) True LOC110530159
TU822297 lncRNA downstream 209744 55186561 ~ 55186880 (-) True G723844
TU822296 lncRNA downstream 210497 55185627 ~ 55186127 (-) True G723843
TU822430 lncRNA upstream 2164 55399049 ~ 55399513 (-) True G723967
TU822432 lncRNA upstream 5727 55402612 ~ 55403050 (-) True G723969
TU822433 lncRNA upstream 7659 55404544 ~ 55404942 (-) True G723970
TU822434 lncRNA upstream 8422 55405307 ~ 55405879 (-) True G723971
TU822449 lncRNA upstream 26169 55423054 ~ 55470008 (-) True G723979
XM_021613014.2 mRNA downstream 59026 55335612 ~ 55337598 (-) True LOC110530163
XM_021613016.2 mRNA downstream 59037 55335612 ~ 55337587 (-) False LOC110530163
XM_021613011.2 mRNA downstream 83020 55304680 ~ 55313604 (-) True LOC110530161
XR_005052911.1 mRNA downstream 173296 55217971 ~ 55223328 (-) False LOC110530159
XR_005052912.1 mRNA downstream 181891 55211750 ~ 55214733 (-) True LOC118965529
XM_036985719.1 mRNA upstream 26781 55423666 ~ 55456049 (-) False si:ch211-106h4.4
XM_036985720.1 mRNA upstream 30839 55427724 ~ 55456052 (-) True si:ch211-106h4.4
XM_036985721.1 mRNA upstream 64311 55461196 ~ 55468070 (-) True LOC110530166
XM_021613024.2 mRNA upstream 136731 55533616 ~ 55544134 (-) False odr4
XM_021613026.2 mRNA upstream 136735 55533620 ~ 55543988 (-) False odr4
TU822417 other downstream 18848 55377281 ~ 55377776 (-) True G723955
TU821231 other downstream 1114646 54281685 ~ 54281978 (-) True G722864
TU821220 other downstream 1145078 54251114 ~ 54251546 (-) True G722854
TU821119 other downstream 1257283 54124379 ~ 54139341 (-) True G722761
TU821019 other downstream 1468665 53926228 ~ 53927959 (-) True G722670
TU822777 other upstream 238653 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 388632 55785517 ~ 55791485 (-) True G724400
TU823541 other upstream 723318 56120203 ~ 56128288 (-) False G724943
TU823623 other upstream 822631 56219516 ~ 56232939 (-) True G725007
TU823714 other upstream 977768 56374653 ~ 56386516 (-) False LOC110530186

Expression Profile


TU822429 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU822429 Expression in each Bioproject

Bar chart with 20 bars.
TU822429 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.