RNA id: TU822754



Basic Information


Item Value
RNA id TU822754
length 219
lncRNA type intronic
GC content 0.50
exon number 2
gene id G724264
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 55575059 ~ 55575687 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tctctctctctctgtgtctctctctctgtgtctctctctctctgtgtctctctctctctgtgtctctcactctctgtgtctctcgctctttgtgtctctctctctctgtgtgtctctctctgtgtctctctctctctgtgtgtctctctctctctgtgtgtctctctctgtgtctctctctctctgtgtgtgtctctctctctgtgtctctctctctct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU822734 lncRNA downstream 27942 55546847 ~ 55547117 (-) True G724246
TU822733 lncRNA downstream 29064 55545734 ~ 55545995 (-) True G724245
TU822513 lncRNA downstream 64495 55510338 ~ 55510564 (-) True G724042
TU822491 lncRNA downstream 75199 55499466 ~ 55499860 (-) True G724020
TU822449 lncRNA downstream 105051 55423054 ~ 55470008 (-) True G723979
TU822762 lncRNA upstream 12801 55588488 ~ 55589616 (-) True G724272
TU822856 lncRNA upstream 142177 55717864 ~ 55718713 (-) True G724366
TU822860 lncRNA upstream 145397 55721084 ~ 55721324 (-) True G724370
TU822861 lncRNA upstream 146416 55722103 ~ 55722418 (-) True G724371
TU822862 lncRNA upstream 147290 55722977 ~ 55723486 (-) True G724372
XM_036986877.1 mRNA downstream 10960 55555878 ~ 55564099 (-) True LOC118965626
XM_021613024.2 mRNA downstream 30925 55533616 ~ 55544134 (-) False odr4
XM_021613025.2 mRNA downstream 30953 55533620 ~ 55544106 (-) True odr4
XM_021613026.2 mRNA downstream 31071 55533620 ~ 55543988 (-) False odr4
XM_036985721.1 mRNA downstream 106989 55461196 ~ 55468070 (-) True LOC110530166
XM_036985723.1 mRNA upstream 107938 55683625 ~ 55688982 (-) False LOC110530171
XM_036985724.1 mRNA upstream 107938 55683625 ~ 55688982 (-) False LOC110530171
XM_036985726.1 mRNA upstream 107938 55683625 ~ 55688983 (-) False LOC110530171
XM_036985725.1 mRNA upstream 107938 55683625 ~ 55688984 (-) True LOC110530171
XM_036985738.1 mRNA upstream 154747 55730434 ~ 55763921 (-) False LOC110530174
TU822429 other downstream 178174 55396624 ~ 55396885 (-) True G723966
TU822417 other downstream 197283 55377281 ~ 55377776 (-) True G723955
TU821231 other downstream 1293081 54281685 ~ 54281978 (-) True G722864
TU821220 other downstream 1323513 54251114 ~ 54251546 (-) True G722854
TU821119 other downstream 1435718 54124379 ~ 54139341 (-) True G722761
TU822777 other upstream 59851 55635538 ~ 55646014 (-) True G724287
TU822909 other upstream 209830 55785517 ~ 55791485 (-) True G724400
TU823541 other upstream 544516 56120203 ~ 56128288 (-) False G724943
TU823623 other upstream 643829 56219516 ~ 56232939 (-) True G725007
TU823714 other upstream 798966 56374653 ~ 56386516 (-) False LOC110530186

Expression Profile


TU822754 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

TU822754 Expression in each Bioproject

Bar chart with 13 bars.
TU822754 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.