RNA id: TU823297



Basic Information


Item Value
RNA id TU823297
length 270
lncRNA type inter_gene
GC content 0.39
exon number 1
gene id G724756
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 56106595 ~ 56106864 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cttagatatttgtatgcttgtatgctcagttagattatatgcaacgcaggacacactagataatatctagtaatatcatcaaccatgtgtagttaactagtgattatgattgattgttttttataagataagtttaatgctagctagcaacttaccttggcttactgcattcgcgtaacactccttgtggagtgcaacgagagagaggcaggtcgttattgcgttggactagttaactgtaaggttgcaagattggatccccgagctgac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU823197 lncRNA downstream 128150 55977933 ~ 55978445 (-) True G724665
TU823146 lncRNA downstream 196525 55909708 ~ 55910070 (-) True G724617
TU823139 lncRNA downstream 207366 55899012 ~ 55899229 (-) True G724610
TU823131 lncRNA downstream 222734 55883655 ~ 55883861 (-) True G724602
TU823116 lncRNA downstream 227872 55873021 ~ 55878723 (-) True LOC110530179
TU823301 lncRNA upstream 1329 56108193 ~ 56108409 (-) True G724760
TU823526 lncRNA upstream 2341 56109205 ~ 56200750 (-) True G724930
TU823540 lncRNA upstream 13339 56120203 ~ 56125531 (-) False G724943
TU823545 lncRNA upstream 13339 56120203 ~ 56128288 (-) True G724943
TU823583 lncRNA upstream 63216 56170080 ~ 56183166 (-) False G724978
XM_021613047.2 mRNA downstream 210253 55872953 ~ 55896342 (-) False LOC110530179
XM_021613046.2 mRNA downstream 267254 55815384 ~ 55839341 (-) True LOC110530178
XM_036985739.1 mRNA downstream 291667 55799908 ~ 55814928 (-) False LOC110530176
XM_021613042.2 mRNA downstream 292247 55801428 ~ 55814348 (-) True LOC110530176
XM_021613041.2 mRNA downstream 292252 55799908 ~ 55814343 (-) False LOC110530176
XM_021613049.2 mRNA upstream 168227 56275091 ~ 56294377 (-) True LOC110530183
XM_021613052.2 mRNA upstream 267724 56374588 ~ 56386152 (-) False LOC110530186
XM_021613051.2 mRNA upstream 267724 56374588 ~ 56386539 (-) False LOC110530186
XM_021613053.2 mRNA upstream 267724 56374588 ~ 56386555 (-) False LOC110530186
XM_021613061.2 mRNA upstream 363277 56470141 ~ 56486902 (-) False LOC110530191
TU822909 other downstream 315110 55785517 ~ 55791485 (-) True G724400
TU822777 other downstream 460581 55635538 ~ 55646014 (-) True G724287
TU822429 other downstream 709710 55396624 ~ 55396885 (-) True G723966
TU822417 other downstream 728819 55377281 ~ 55377776 (-) True G723955
TU821231 other downstream 1824617 54281685 ~ 54281978 (-) True G722864
TU823541 other upstream 13339 56120203 ~ 56128288 (-) False G724943
TU823623 other upstream 112652 56219516 ~ 56232939 (-) True G725007
TU823714 other upstream 267789 56374653 ~ 56386516 (-) False LOC110530186
TU823713 other upstream 276265 56383129 ~ 56386516 (-) True LOC110530186
TU823957 other upstream 481479 56588343 ~ 56589271 (-) True G725280

Expression Profile


TU823297 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU823297 Expression in each Bioproject

Bar chart with 21 bars.
TU823297 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.