RNA id: TCONS_00035770


Basic Information

Item Value
RNA id TCONS_00035770
length 574
RNA type processed_transcript
GC content 0.47
exon number 6
gene id XLOC_018144
representative True

Chromosome Information

Item Value
chromosome id NC_007131.7
NCBI id CM002904.2
chromosome length 55201332
location 29036328 ~ 29052391 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

GCATGTTAACAGAAGCGATGAGAAGTACTAACCACTTGTGGATTTTTAGGGGGTGTTGCAAAACGTGCGCTTTGTATTCGGAACCACGCTGGAAGCCATCCTGAGGAATAAAGGGTGCCAAAACTCAATGACTGATATCATTACCCTTGACAATCCCATAAATGGATCCAGCCCTGCAATCAGGACAGATTACACTGGCCACAAAACAAAAGATCTGCAAATGATTTGTGGCTTTTCATGTGAGGATCTGGCTGCCATGTTTAAGGAACTGAAAGGTCTTGGTGTGGTGGTTCAAGAACTGTCCAATGAACTCCGAAAAGTGACGGATGACAAAAACATGCTCATGAATCAAATGGGCATTCGTGCTGGTGTATGTCTTCACAATGGAATTGTGCACAAAAACAAGGAGGAATGGACAGTGGACGACTGCACAGAGTGCACTTGCCAGAATTCTGCAACGGTGTGCCGCAAGATTTCATGTCCCCTAATCCCATGTGCAAATGCCACAGTACCTGATGGAGAGTGCTGCCCTCGCTGTGGAACACCGAGCGACTCCGCCGAGGATGGTTGGTCC

Function

GO:

id name namespace
GO:0006954 inflammatory response biological_process
GO:0016525 negative regulation of angiogenesis biological_process
GO:0007155 cell adhesion biological_process
GO:0062023 collagen-containing extracellular matrix cellular_component
GO:0005576 extracellular region cellular_component
GO:0005615 extracellular space cellular_component
GO:0005509 calcium ion binding molecular_function
GO:0008201 heparin binding molecular_function
GO:0050840 extracellular matrix binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-020708-1 Predicted to enable calcium ion binding activity; extracellular matrix binding activity; and heparin binding activity. Predicted to be involved in negative regulation of angiogenesis. Predicted to act upstream of or within cell adhesion and inflammatory response. Predicted to be located in extracellular space. Predicted to be active in collagen-containing extracellular matrix. Is expressed in several structures, including axial vasculature; head mesenchyme; nervous system; pectoral fin; and somite. Human ortholog(s) of this gene implicated in cholangiocarcinoma; pancreatic cancer; and pancreatic ductal carcinoma. Orthologous to human THBS1 (thrombospondin 1).

Ensembl:

ensembl_id ENSDART00000153143

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00036854 lncRNA downstream 183301 28860442 ~ 28863882 (-) True XLOC_018140
TCONS_00035758 lncRNA downstream 204693 28835369 ~ 28842490 (-) True XLOC_018139
TCONS_00036477 lncRNA downstream 405342 28638760 ~ 28641841 (-) True XLOC_018135
TCONS_00035738 lncRNA downstream 752079 28284780 ~ 28295104 (-) True XLOC_018131
TCONS_00036853 lncRNA downstream 777942 28267530 ~ 28269241 (-) False XLOC_018131
TCONS_00036478 lncRNA upstream 376893 29426938 ~ 29429462 (-) True XLOC_018147
TCONS_00035778 lncRNA upstream 423542 29473587 ~ 29474495 (-) True XLOC_018148
TCONS_00035793 lncRNA upstream 477146 29527191 ~ 29529831 (-) True XLOC_018153
TCONS_00035795 lncRNA upstream 573506 29623551 ~ 29626488 (-) False XLOC_018154
TCONS_00035796 lncRNA upstream 573513 29623558 ~ 29625984 (-) True XLOC_018154
TCONS_00035766 mRNA downstream 90880 28946709 ~ 28956303 (-) True XLOC_018143
TCONS_00035764 mRNA downstream 115145 28885990 ~ 28932038 (-) False XLOC_018142
TCONS_00035765 mRNA downstream 115282 28888753 ~ 28931901 (-) True XLOC_018142
TCONS_00035761 mRNA downstream 162354 28876736 ~ 28884829 (-) False XLOC_018141
TCONS_00035763 mRNA downstream 162355 28878254 ~ 28884828 (-) True XLOC_018141
TCONS_00035771 mRNA upstream 178292 29228337 ~ 29229854 (-) True XLOC_018145
TCONS_00035772 mRNA upstream 218399 29268444 ~ 29420713 (-) False XLOC_018146
TCONS_00035773 mRNA upstream 219738 29269783 ~ 29418620 (-) True XLOC_018146
TCONS_00035774 mRNA upstream 419708 29469753 ~ 29471577 (-) False XLOC_018148
TCONS_00035775 mRNA upstream 421106 29471151 ~ 29475172 (-) False XLOC_018148
TCONS_00035760 other downstream 171309 28871885 ~ 28875874 (-) False XLOC_018141
TCONS_00035753 other downstream 204612 28832762 ~ 28842571 (-) False XLOC_018139
TCONS_00035747 other downstream 434861 28611272 ~ 28612322 (-) True XLOC_018136
TCONS_00035726 other downstream 1735568 27308416 ~ 27311615 (-) True XLOC_018122
TCONS_00035722 other downstream 1821305 27224812 ~ 27225878 (-) True XLOC_018121
TCONS_00035788 other upstream 445255 29495300 ~ 29495435 (-) True XLOC_018151
TCONS_00035811 other upstream 1322618 30372663 ~ 30372883 (-) True XLOC_018166
TCONS_00035812 other upstream 1323162 30373207 ~ 30373427 (-) True XLOC_018167
TCONS_00035813 other upstream 1323820 30373865 ~ 30374084 (-) True XLOC_018168
TCONS_00035814 other upstream 1324641 30374686 ~ 30374906 (-) True XLOC_018169

Expression Profile

//