RNA id: TU850190



Basic Information


Item Value
RNA id TU850190
length 517
lncRNA type intronic
GC content 0.46
exon number 1
gene id G748931
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 77216516 ~ 77217032 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tgattacacacaggtggattgtatttatcatcattagtcatttaggtcaatattgtatcattcagagatcctcactgaacttctggagagagtttgctgcactgaaagtaaaggggctgaataattttgcacgcccaatttttcagtttttgattcaagggggccgaatactttcgcaaggcactgtacagggggtaccagggaacagagtcaatgtggaggttatatacagggggtactggtacagagttaatgtggaggctatatacagggggtaccagggaacagagtcaatgtggaggctatatacagggggtaccagggaacagagttaatgtggaggctatatacagggggtaccaggggacagagtcaatgtggaggctatatacagggtgtaccagggaacagagttaatgtggagactatatacagggggtaccaggacagagtcaatgtggagactatatacagggggtaccagggaacagagttaatgtggaggctatatacgggg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU850189 lncRNA upstream 362 77215942 ~ 77216154 (+) True G748930
TU850148 lncRNA upstream 4056 77211232 ~ 77212460 (+) True G748895
TU850149 lncRNA upstream 4330 77211182 ~ 77212186 (+) False G748895
TU850178 lncRNA upstream 35220 77180597 ~ 77181296 (+) True G748919
TU850158 lncRNA upstream 43353 77143204 ~ 77173163 (+) True G748903
TU850192 lncRNA downstream 4039 77221071 ~ 77221307 (+) True G748933
TU850194 lncRNA downstream 5325 77222357 ~ 77222866 (+) True G748935
TU850204 lncRNA downstream 18375 77235407 ~ 77235632 (+) True G748945
TU850205 lncRNA downstream 19277 77236309 ~ 77236586 (+) True G748946
TU850210 lncRNA downstream 29169 77246201 ~ 77264007 (+) False G748951
XM_021613888.2 mRNA upstream 5702 77181864 ~ 77210814 (+) False LOC110530663
XM_021613889.2 mRNA upstream 5702 77181864 ~ 77210814 (+) True LOC110530663
XM_036986302.1 mRNA upstream 60952 77127486 ~ 77155564 (+) False slc25a12
XM_036986303.1 mRNA upstream 60952 77127698 ~ 77155564 (+) True slc25a12
XM_036986884.1 mRNA upstream 127211 77087135 ~ 77089305 (+) False LOC118965635
XM_021613911.2 mRNA downstream 95369 77312401 ~ 77328589 (+) False LOC110530673
XM_021613912.2 mRNA downstream 95369 77312401 ~ 77328589 (+) False LOC110530673
XR_002474569.2 mRNA downstream 95369 77312401 ~ 77344087 (+) True LOC110530673
XM_021613909.2 mRNA downstream 155155 77372187 ~ 77377386 (+) True LOC110530672
XR_002474571.2 mRNA downstream 168549 77385581 ~ 77386837 (+) False LOC110530676
TU850174 other upstream 36388 77179344 ~ 77180128 (+) True G748917
TU850161 other upstream 39167 77150663 ~ 77177349 (+) True G748905
TU849632 other upstream 508872 76706730 ~ 76707644 (+) False G748432
TU849434 other upstream 764079 76451570 ~ 76452437 (+) True LOC110530655
TU849158 other upstream 822187 76239950 ~ 76394329 (+) True G747987
TU850224 other downstream 49620 77266652 ~ 77272660 (+) True G748959
TU850462 other downstream 85705 77302737 ~ 77356024 (+) False G749137
TU850453 other downstream 136605 77353637 ~ 77356024 (+) False G749137
TU850461 other downstream 136605 77353637 ~ 77382611 (+) False G749137
TU850834 other downstream 667205 77884237 ~ 77887356 (+) False LOC110530993

Expression Profile


TU850190 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU850190 Expression in each Bioproject

Bar chart with 15 bars.
TU850190 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.