RNA id: TU858727



Basic Information


Item Value
RNA id TU858727
length 986
lncRNA type inter_gene
GC content 0.42
exon number 1
gene id G756017
representative True

Chromosome Information


Item Value
chromosome id NC_048572.1
NCBI id CM023226.2
chromosome length 91622588
location 84389196 ~ 84390181 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


actgtatatacagtgccttgcgaaagtattcggcccccttgaactctgcgaccttttgccacatttcaggcttcaaacataaagatataaaactgtatttttttgtgaagaatcaacaacaagtgggacacaatcatgaagtggaacgacatttattggatatttcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagccccccttaagttaatactttgtagcgccaccttttgctgcgattacagctgtaagtcgcttggggtatgtctctatcagttttgcacatcgagagactgacattttttcccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagattttgctttatgttttggatcattgtcttgttggaagacaaatctccgtcccagtctcaggtctttggcagactccgtcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggcccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagggtgttgcttttacgccaaacataacattttgcattgttgccaaaaagttcaattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaaaaaatgtctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgtcctatggacagagtctcccacctcagctgtagatctctgcagt

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU858704 lncRNA upstream 12839 84374448 ~ 84376357 (+) True G755995
TU858289 lncRNA upstream 36598 84352319 ~ 84352598 (+) True G755632
TU858288 lncRNA upstream 38133 84350684 ~ 84351063 (+) True G755631
TU858285 lncRNA upstream 41293 84347619 ~ 84347903 (+) True G755628
TU858280 lncRNA upstream 49044 84339893 ~ 84340152 (+) True G755624
TU858791 lncRNA downstream 59003 84449184 ~ 84450948 (+) True G756072
TU858801 lncRNA downstream 81128 84471309 ~ 84475065 (+) True G756082
TU858800 lncRNA downstream 82053 84472234 ~ 84472885 (+) True G756081
TU858862 lncRNA downstream 153488 84543669 ~ 84543962 (+) True G756126
TU858866 lncRNA downstream 160313 84550494 ~ 84600254 (+) False G756129
XM_021614101.2 mRNA upstream 436463 83950870 ~ 83952733 (+) True tceanc2
XM_021614096.2 mRNA upstream 470289 83913983 ~ 83918907 (+) False lrrc42
XM_021614095.2 mRNA upstream 470289 83913996 ~ 83918907 (+) True lrrc42
XM_021614093.2 mRNA upstream 485915 83895686 ~ 83903281 (+) False LOC110530814
XM_036986572.1 mRNA downstream 46307 84436488 ~ 84931644 (+) False LOC110492646
XM_036986574.1 mRNA downstream 46307 84436488 ~ 84931644 (+) False LOC110492646
XM_036986575.1 mRNA downstream 46307 84436488 ~ 84931644 (+) False LOC110492646
XM_036986576.1 mRNA downstream 46307 84436488 ~ 84931644 (+) False LOC110492646
XM_036986577.1 mRNA downstream 46307 84436488 ~ 84931644 (+) False LOC110492646
TU858258 other upstream 80922 84303470 ~ 84308274 (+) True G755602
TU858237 other upstream 126230 84261987 ~ 84262966 (+) True G755585
TU858056 other upstream 418499 83969378 ~ 83970697 (+) True G755428
TU857978 other upstream 483584 83903635 ~ 83905612 (+) True LOC110530814
TU857984 other upstream 499559 83886814 ~ 83889637 (+) True G755363
TU858875 other downstream 168605 84558786 ~ 84561891 (+) True G756134
TU859041 other downstream 486813 84876994 ~ 84878079 (+) True G756271
TU859074 other downstream 545885 84936066 ~ 84937744 (+) False G756298
TU859075 other downstream 545885 84936066 ~ 84937147 (+) False G756298
TU859221 other downstream 866601 85256782 ~ 85264093 (+) True LOC118965572

Expression Profile


TU858727 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU858727 Expression in each Bioproject

Bar chart with 21 bars.
TU858727 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.