RNA id: TU916494



Basic Information


Item Value
RNA id TU916494
length 346
RNA type TUCP
GC content 0.56
exon number 1
gene id G805451
representative True

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 42332093 ~ 42332438 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


cattcactcaccgtaacagaagaatccgaccaggaatggacccagcgacttcggatcctctccactcagccgtcgagatccagggagcgatgctaggcagacacgagcaggaattgtctgctgctcgacatgccgttgagaccctggccacccaagtctccaacctcacagaacaggttcaccatctccgcctcgatccaccggccacttccagggctttcgaatctccagagcccagaatcaataacccgccgtgttactctggggagcccactgaatgccgctcgttcctcacccagtgtgatattgtgttttctctccagcccaacacttactccaggagcac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU916463 lncRNA upstream 41093 42289554 ~ 42291000 (+) True G805423
TU916462 lncRNA upstream 42545 42289290 ~ 42289548 (+) True G805422
TU916362 lncRNA upstream 114026 42157527 ~ 42218067 (+) True G805323
TU916387 lncRNA upstream 177594 42154291 ~ 42154499 (+) True G805348
TU916383 lncRNA upstream 180554 42151295 ~ 42151539 (+) True G805344
TU916661 lncRNA downstream 13163 42345601 ~ 42345839 (+) True G805601
TU916703 lncRNA downstream 66207 42398645 ~ 42398855 (+) True G805638
TU916705 lncRNA downstream 68876 42401314 ~ 42401631 (+) True G805640
TU916742 lncRNA downstream 125192 42457630 ~ 42457832 (+) True G805673
TU916767 lncRNA downstream 164423 42496861 ~ 42519512 (+) True glut1b
XM_021615744.2 mRNA upstream 85667 42237344 ~ 42246426 (+) True LOC110532123
XM_021615741.2 mRNA upstream 95454 42209835 ~ 42236639 (+) False LOC110532122
XM_021615740.2 mRNA upstream 95454 42209837 ~ 42236639 (+) True LOC110532122
XR_005053251.1 mRNA upstream 152772 42160412 ~ 42179321 (+) False LOC118966050
XR_005053252.1 mRNA upstream 152772 42174848 ~ 42179321 (+) True LOC118966050
XM_021615752.2 mRNA downstream 92644 42425082 ~ 42431053 (+) True LOC110532129
XM_021617145.2 mRNA downstream 184708 42517146 ~ 42529048 (+) False glut1b
XM_021615761.2 mRNA downstream 208583 42541021 ~ 42546531 (+) True trappc6b
XM_021615760.2 mRNA downstream 214407 42546845 ~ 42556493 (+) False tpx2
XM_021615759.2 mRNA downstream 214408 42546846 ~ 42556493 (+) True tpx2
TU916102 other upstream 307690 42021859 ~ 42024403 (+) True LOC110532114
TU914750 other upstream 896670 41434884 ~ 41435423 (+) False LOC110532096
TU914604 other upstream 1310591 41020936 ~ 41021502 (+) True G803728
TU914302 other upstream 1864091 40467628 ~ 40468002 (+) True G803457
TU914281 other upstream 1882154 40442896 ~ 40449939 (+) True G803437
TU916660 other downstream 13738 42346176 ~ 42348786 (+) True G805600
TU919016 other downstream 1863277 44195715 ~ 44196041 (+) True G807677
TU919191 other downstream 2110224 44442662 ~ 44453077 (+) True G807841
TU921250 other downstream 3802293 46134731 ~ 46135732 (+) True G809685
TU923963 other downstream 5649563 47982001 ~ 47982301 (+) True G812143

Expression Profile


TU916494 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

TU916494 Expression in each Bioproject

Bar chart with 14 bars.
TU916494 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.