RNA id: TU916742



Basic Information


Item Value
RNA id TU916742
length 203
lncRNA type intronic
GC content 0.46
exon number 1
gene id G805673
representative True

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 42457630 ~ 42457832 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gggcttagtgggactatcatttctttttcaacaggaaaatgacccaaaacacacctccaggctgtgtaatggctattttaccaagaaggagagtgatggagtgctgcatcagatgacctggcctccacaatccctgacctcaaccaaattgagatgttttgggatgagtcagaccgcagagagaaggaaaagcaaccaacaag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU916705 lncRNA upstream 55999 42401314 ~ 42401631 (+) True G805640
TU916703 lncRNA upstream 58775 42398645 ~ 42398855 (+) True G805638
TU916661 lncRNA upstream 111791 42345601 ~ 42345839 (+) True G805601
TU916463 lncRNA upstream 166630 42289554 ~ 42291000 (+) True G805423
TU916462 lncRNA upstream 168082 42289290 ~ 42289548 (+) True G805422
TU916767 lncRNA downstream 39029 42496861 ~ 42519512 (+) True glut1b
TU916764 lncRNA downstream 74550 42532382 ~ 42534870 (+) False G805694
TU916765 lncRNA downstream 74550 42532382 ~ 42579499 (+) True G805694
TU916827 lncRNA downstream 157028 42614860 ~ 42615200 (+) True G805749
TU916858 lncRNA downstream 203983 42661815 ~ 42664451 (+) True G805779
XM_021615752.2 mRNA upstream 26577 42425082 ~ 42431053 (+) True LOC110532129
XM_021615744.2 mRNA upstream 211204 42237344 ~ 42246426 (+) True LOC110532123
XM_021615741.2 mRNA upstream 220991 42209835 ~ 42236639 (+) False LOC110532122
XM_021615740.2 mRNA upstream 220991 42209837 ~ 42236639 (+) True LOC110532122
XR_005053251.1 mRNA upstream 278309 42160412 ~ 42179321 (+) False LOC118966050
XM_021617145.2 mRNA downstream 59314 42517146 ~ 42529048 (+) False glut1b
XM_021615761.2 mRNA downstream 83189 42541021 ~ 42546531 (+) True trappc6b
XM_021615760.2 mRNA downstream 89013 42546845 ~ 42556493 (+) False tpx2
XM_021615759.2 mRNA downstream 89014 42546846 ~ 42556493 (+) True tpx2
XM_036988050.1 mRNA downstream 105576 42563408 ~ 42564593 (+) False LOC110532135
TU916660 other upstream 108844 42346176 ~ 42348786 (+) True G805600
TU916494 other upstream 125192 42332093 ~ 42332438 (+) True G805451
TU916102 other upstream 433227 42021859 ~ 42024403 (+) True LOC110532114
TU914750 other upstream 1022207 41434884 ~ 41435423 (+) False LOC110532096
TU914604 other upstream 1436128 41020936 ~ 41021502 (+) True G803728
TU919016 other downstream 1737883 44195715 ~ 44196041 (+) True G807677
TU919191 other downstream 1984830 44442662 ~ 44453077 (+) True G807841
TU921250 other downstream 3676899 46134731 ~ 46135732 (+) True G809685
TU923963 other downstream 5524169 47982001 ~ 47982301 (+) True G812143
TU924562 other downstream 6087622 48545454 ~ 48570593 (+) True G812688

Expression Profile


TU916742 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU916742 Expression in each Bioproject

Bar chart with 19 bars.
TU916742 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.