RNA id: TU937368



Basic Information


Item Value
RNA id TU937368
length 389
RNA type TUCP
GC content 0.60
exon number 1
gene id G824405
representative True

Chromosome Information


Item Value
chromosome id NC_048573.1
NCBI id CM023227.2
chromosome length 79455637
location 58440470 ~ 58440858 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctttttctccccaatttcgtggtatccaattgttgtagtagctactatcttgtctcatcgctacaactcccgtacgggctcaggagagacgaaggttgaaagtcatgcgtcctccgatacacaacccaaccaagccgcactgcttcttaacacagcacgcatccaacccggaagccagccgcaccaatgcgccggaggaaacaccgtgcacctggccaccttggttagcgcacactgcgctcagcccgccacaagagtcgctggtgcgcgatgagacaaggacacccctaccgaccaagccctccctaacccgggcgacgctaggccaattgtgcgtccccccacggacctcccggtcgcggccggttacgacagagcctgggcgcgaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU937366 lncRNA downstream 2797 58437375 ~ 58437673 (-) True G824403
TU937339 lncRNA downstream 48354 58391752 ~ 58392116 (-) True G824386
TU937338 lncRNA downstream 49299 58388168 ~ 58391171 (-) True G824385
TU937340 lncRNA downstream 54168 58385476 ~ 58386302 (-) True G824387
TU937321 lncRNA downstream 80246 58359372 ~ 58360224 (-) True G824377
TU937370 lncRNA upstream 1525 58442383 ~ 58442689 (-) True G824407
TU937433 lncRNA upstream 119767 58560625 ~ 58561171 (-) True G824452
TU937467 lncRNA upstream 185496 58626354 ~ 58626740 (-) True G824479
TU937474 lncRNA upstream 195016 58635874 ~ 58636135 (-) True G824486
TU937476 lncRNA upstream 195482 58636340 ~ 58636609 (-) True G824488
XM_021616437.2 mRNA downstream 8073 58430195 ~ 58432397 (-) True LOC110532484
XM_021616435.2 mRNA downstream 17837 58407945 ~ 58422633 (-) True LOC110532482
XM_021616436.2 mRNA downstream 18165 58407945 ~ 58422305 (-) False LOC110532482
XM_021616428.2 mRNA downstream 34853 58398426 ~ 58405617 (-) True LOC110532481
XM_021616431.2 mRNA downstream 34925 58398426 ~ 58405545 (-) False LOC110532481
XM_021616438.2 mRNA upstream 55739 58496597 ~ 58518184 (-) False LOC110532487
XM_021616441.2 mRNA upstream 55739 58496597 ~ 58518184 (-) False LOC110532487
XM_021616439.2 mRNA upstream 55739 58496597 ~ 58518185 (-) False LOC110532487
XM_021616440.2 mRNA upstream 55739 58496597 ~ 58518185 (-) False LOC110532487
XM_036988499.1 mRNA upstream 55739 58496597 ~ 58518185 (-) True LOC110532487
TU934518 other downstream 2297042 56133154 ~ 56143428 (-) True LOC110532429
TU934516 other downstream 2297099 56133004 ~ 56143371 (-) False LOC110532429
TU934517 other downstream 2297099 56133154 ~ 56143371 (-) False LOC110532429
TU934476 other downstream 2453953 55985960 ~ 55986517 (-) True G821851
TU933570 other downstream 3016911 55422543 ~ 55423559 (-) True G821013
TU938076 other upstream 223924 58664782 ~ 58668085 (-) False LOC110531218
TU938079 other upstream 223924 58664782 ~ 58668085 (-) False LOC110531218
TU938424 other upstream 781685 59222543 ~ 59223481 (-) True LOC118966080
TU939209 other upstream 1197488 59638346 ~ 59638894 (-) True G825961
TU939603 other upstream 1810743 60251601 ~ 60275741 (-) True LOC110532567

Expression Profile


TU937368 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU937368 Expression in each Bioproject

Bar chart with 19 bars.
TU937368 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.