RNA id: TCONS_00003745


Basic Information

Item Value
RNA id TCONS_00003745
length 418
RNA type mRNA
GC content 0.47
exon number 2
gene id XLOC_001894
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 7671260 ~ 7672949 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

ATGCTTTAGGTGTAGTAGGAGGTGACCTTACTGAAGTATTACAGAATTTTTTGCTATTTGCTTTCATTTCAGAAAGGCACATTTGAACAGTTTGGTAATGATTTCAAGTTTGCTTAGCTCGACGTGTTGATTTTGATCGAGGGCTTTATAGAGTTGCTGCTCGAAGAGGAAACTGTAGAATATAACTATAATGGCAGAGGCTCAGCAGGCTCGAGTGCAGAATGCAGTGGAGGAGATGGTACAGAACCTGGAGAAAGAGCACATCCGAAAGATGCAGGGCCGCATGTTCCGCTGCAGTGCAGAGTGCTGTGAGCATCCTGGGAACTCCATGAATCAGGTGCATCAGTGTATCGAGCGCTGCCACACACCTCTGGCTAAAGCCCAAGGCCTGGTCACCAGTGAACTCGAGCAGTTTCAG

Function

GO:

id name namespace
GO:0008150 biological_process biological_process
GO:0005737 cytoplasm cellular_component
GO:0003674 molecular_function molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2729 Predicted to be active in cytoplasm. Is expressed in several structures, including alar plate midbrain region; digestive system; eye; musculature system; and optic tectum. Orthologous to human FAM136A (family with sequence similarity 136 member A).

Ensembl:

ensembl_id ENSDART00000157608

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00003730 lncRNA upstream 568506 7083739 ~ 7102754 (+) False XLOC_001887
TCONS_00005823 lncRNA upstream 915494 6754270 ~ 6755766 (+) True XLOC_001884
TCONS_00005822 lncRNA upstream 986464 6684418 ~ 6684796 (+) True XLOC_001880
TCONS_00005821 lncRNA upstream 1026485 6644397 ~ 6644775 (+) True XLOC_001878
TCONS_00005820 lncRNA upstream 1042263 6628619 ~ 6628997 (+) True XLOC_001877
TCONS_00005678 lncRNA downstream 135762 7808711 ~ 7809243 (+) True XLOC_001897
TCONS_00005824 lncRNA downstream 170457 7843406 ~ 7849873 (+) True XLOC_001898
TCONS_00005825 lncRNA downstream 197660 7870609 ~ 7901888 (+) True XLOC_001899
TCONS_00005826 lncRNA downstream 305568 7978517 ~ 7984582 (+) True XLOC_001900
TCONS_00005679 lncRNA downstream 315076 7988025 ~ 7992459 (+) True XLOC_001901
TCONS_00003744 mRNA upstream 30463 7636811 ~ 7640797 (+) True XLOC_001893
TCONS_00003741 mRNA upstream 53512 7593185 ~ 7617748 (+) False XLOC_001892
TCONS_00003743 mRNA upstream 53521 7593229 ~ 7617739 (+) True XLOC_001892
TCONS_00003742 mRNA upstream 64033 7593196 ~ 7607227 (+) False XLOC_001892
TCONS_00003740 mRNA upstream 82382 7585928 ~ 7588878 (+) True XLOC_001891
TCONS_00003746 mRNA downstream 30302 7703251 ~ 7721903 (+) False XLOC_001895
TCONS_00003747 mRNA downstream 36775 7709724 ~ 7723457 (+) False XLOC_001895
TCONS_00003748 mRNA downstream 45207 7718156 ~ 7721764 (+) False XLOC_001895
TCONS_00003749 mRNA downstream 46847 7719796 ~ 7721764 (+) True XLOC_001895
TCONS_00003750 mRNA downstream 125138 7798087 ~ 7805010 (+) True XLOC_001896
TCONS_00003739 other upstream 93209 7573316 ~ 7578051 (+) True XLOC_001890
TCONS_00003731 other upstream 461152 7083771 ~ 7210108 (+) False XLOC_001887
TCONS_00003693 other upstream 1901648 5744923 ~ 5769612 (+) False XLOC_001866
TCONS_00003679 other upstream 2518859 5151349 ~ 5152401 (+) True XLOC_001855
TCONS_00003675 other upstream 2523678 5135842 ~ 5147582 (+) True XLOC_001854
TCONS_00003759 other downstream 670239 8343188 ~ 8343305 (+) True XLOC_001906
TCONS_00003778 other downstream 1189572 8862521 ~ 8868895 (+) True XLOC_001921
TCONS_00003779 other downstream 1196519 8869468 ~ 8880126 (+) False XLOC_001922
TCONS_00003791 other downstream 1673447 9346396 ~ 9348506 (+) False XLOC_001931
TCONS_00003802 other downstream 2052825 9725774 ~ 9725891 (+) True XLOC_001937

Expression Profile

//