RNA id: TCONS_00003758


Basic Information

Item Value
RNA id TCONS_00003758
length 535
lncRNA type retained_intron
GC content 0.45
exon number 3
gene id XLOC_001905
representative True

Chromosome Information

Item Value
chromosome id NC_007121.7
NCBI id CM002894.2
chromosome length 45420867
location 8197827 ~ 8266094 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

CAGTGCAGATGAGCTGCTGCTGACAGAGATGATGTTTAACGGCTTGTTCAATGACCTGACGGCGGAGCAGGCCACCGCTCTCCTCAGCTGCTTCGTCTTCCAGGAAAACGCCAACGAGATGCCCAAACTGACAGAGCAGCTGGGCGGTCCACTGAGACAGATGCAGGAATGTGCCAAGAGAATTGCTAAAGTGTCTGCAGAGGCCAAGCTGGAAGTGGACGAGGACAGTTACCTGAACCAGTTCCGTCCGCACCTGATGGATGTGGTCTACACCTGGGCCAATGGCTCTTCTTTCTCTCAGATTTGCAAAATGACAGACGTGTTTGAAGGTAATGGCTCCCAACAAAAACTACTGGATCTGTTTGATTCATTGTGCAATACCTCTAGCTTAAATATCACACATTTTCCAATGTATTTATGATTCAATTTAAACCAGTAATTTTTTTGAAGGCACTTTTTATCCATAGTTCCCAAAAATGGCTTATTTTCGTACCCCATGTTTCCCAGAAATGAACAAATGCAATTAGTTTGGAGA

Function

GO:

id name namespace
GO:0006401 RNA catabolic process biological_process
GO:0051781 positive regulation of cell division biological_process
GO:0000460 maturation of 5.8S rRNA biological_process
GO:0031101 fin regeneration biological_process
GO:0005634 nucleus cellular_component
GO:0005524 ATP binding molecular_function
GO:0003676 nucleic acid binding molecular_function
GO:0003723 RNA binding molecular_function
GO:0003724 RNA helicase activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-040426-2854 Predicted to enable RNA helicase activity. Acts upstream of or within fin regeneration and positive regulation of cell division. Predicted to be active in nucleus. Is expressed in blastomere; nervous system; and pectoral fin. Orthologous to human MTREX (Mtr4 exosome RNA helicase).

Ensembl:

ensembl_id ENSDART00000157843

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00005827 lncRNA upstream 214254 8036184 ~ 8037889 (+) True XLOC_001902
TCONS_00005679 lncRNA upstream 259684 7988025 ~ 7992459 (+) True XLOC_001901
TCONS_00005826 lncRNA upstream 267561 7978517 ~ 7984582 (+) True XLOC_001900
TCONS_00005825 lncRNA upstream 350255 7870609 ~ 7901888 (+) True XLOC_001899
TCONS_00005824 lncRNA upstream 402270 7843406 ~ 7849873 (+) True XLOC_001898
TCONS_00003761 lncRNA downstream 138772 8402096 ~ 8408875 (+) True XLOC_001907
TCONS_00005680 lncRNA downstream 383635 8646959 ~ 8650855 (+) True XLOC_001913
TCONS_00005828 lncRNA downstream 446161 8709485 ~ 8715748 (+) True XLOC_001917
TCONS_00005681 lncRNA downstream 510112 8773436 ~ 8773659 (+) True XLOC_001919
TCONS_00005829 lncRNA downstream 859069 9122393 ~ 9125863 (+) True XLOC_001926
TCONS_00003756 mRNA upstream 109930 8101763 ~ 8142213 (+) True XLOC_001904
TCONS_00003755 mRNA upstream 110220 8101763 ~ 8141923 (+) False XLOC_001904
TCONS_00003754 mRNA upstream 121550 8101729 ~ 8130593 (+) False XLOC_001904
TCONS_00003752 mRNA upstream 154044 8091144 ~ 8098099 (+) False XLOC_001903
TCONS_00003751 mRNA upstream 154051 8091144 ~ 8098092 (+) False XLOC_001903
TCONS_00003760 mRNA downstream 138605 8401929 ~ 8412964 (+) False XLOC_001907
TCONS_00003762 mRNA downstream 174606 8437930 ~ 8468949 (+) True XLOC_001908
TCONS_00003763 mRNA downstream 218336 8481660 ~ 8484001 (+) True XLOC_001909
TCONS_00003764 mRNA downstream 263872 8527196 ~ 8530065 (+) True XLOC_001910
TCONS_00003765 mRNA downstream 271426 8534750 ~ 8576218 (+) False XLOC_001911
TCONS_00003739 other upstream 674092 7573316 ~ 7578051 (+) True XLOC_001890
TCONS_00003731 other upstream 1042035 7083771 ~ 7210108 (+) False XLOC_001887
TCONS_00003693 other upstream 2482531 5744923 ~ 5769612 (+) False XLOC_001866
TCONS_00003679 other upstream 3099742 5151349 ~ 5152401 (+) True XLOC_001855
TCONS_00003675 other upstream 3104561 5135842 ~ 5147582 (+) True XLOC_001854
TCONS_00003759 other downstream 79864 8343188 ~ 8343305 (+) True XLOC_001906
TCONS_00003778 other downstream 599197 8862521 ~ 8868895 (+) True XLOC_001921
TCONS_00003779 other downstream 606144 8869468 ~ 8880126 (+) False XLOC_001922
TCONS_00003791 other downstream 1083072 9346396 ~ 9348506 (+) False XLOC_001931
TCONS_00003802 other downstream 1462450 9725774 ~ 9725891 (+) True XLOC_001937

Expression Profile

//