RNA id: TU972516



Basic Information


Item Value
RNA id TU972516
length 550
RNA type TUCP
GC content 0.45
exon number 1
gene id G853244
representative True

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 11005109 ~ 11005658 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atataactgtttggacataatgaccataattatgtttggaggaaaaagggggaggcttgcaagccgaagaacaccatcccaaccataaagcacgggggtgacagcatcatgttgtgggggtgctttgctgcaggagggactggtgcacttcacaaaataaatggcatcatgaggcaggaaaattatgtggatattttgaagcaacatctcaagacatcagtcaggaagttaaagcttggtcgcaaatgggtcttccaaatggacaataaccccgagcatacttccaaagttgtggcaaaatggcttaaggacaacaaagtcagggtattggagtggccatcacaaagctctgacctcaatcctatagaaaatgtgtgggcagaactgaaaaagcgtgtgcgagcaaggaggcctacaaccctgactcagttacaccagctctgtcaagaggaatggaccaaaattcacccaacttattgtgggaatcttgtggaaggctacctgaaacgtttgacccaagttaaacaatttaaaggcaatgctaccaaaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU972515 lncRNA downstream 82 11004742 ~ 11005027 (-) True G853243
TU972510 lncRNA downstream 4125 11000616 ~ 11000984 (-) True G853238
TU972509 lncRNA downstream 7430 10997299 ~ 10997679 (-) True G853237
TU972486 lncRNA downstream 41528 10963276 ~ 10963581 (-) True G853222
TU972462 lncRNA downstream 100078 10904611 ~ 10905031 (-) True G853202
TU972524 lncRNA upstream 10526 11016184 ~ 11016474 (-) True G853252
TU972534 lncRNA upstream 20430 11026088 ~ 11026346 (-) True bod1
TU972539 lncRNA upstream 26511 11032169 ~ 11032394 (-) True G853265
TU972545 lncRNA upstream 30674 11036332 ~ 11036622 (-) True G853271
TU972550 lncRNA upstream 35532 11041190 ~ 11041391 (-) True G853276
XM_021617448.2 mRNA downstream 11316 10988789 ~ 10993793 (-) True LOC110533336
XM_021617439.2 mRNA downstream 155276 10760682 ~ 10849833 (-) True LOC110533330
XR_005053571.1 mRNA downstream 296033 10707542 ~ 10709076 (-) False LOC118966706
XR_005053572.1 mRNA downstream 296033 10708029 ~ 10709076 (-) False LOC118966706
XR_005053570.1 mRNA downstream 296033 10708381 ~ 10709076 (-) True LOC118966706
XM_021617449.2 mRNA upstream 20429 11026087 ~ 11029511 (-) False bod1
XM_036989695.1 mRNA upstream 20429 11026087 ~ 11029511 (-) False bod1
XR_005034347.1 mRNA upstream 84363 11090021 ~ 11091274 (-) True LOC118936915
XM_021617454.2 mRNA upstream 461723 11467381 ~ 11474701 (-) True LOC110533343
XM_021617455.2 mRNA upstream 556278 11561936 ~ 11564213 (-) True LOC110533344
TU971979 other downstream 542459 10462256 ~ 10462650 (-) True G852802
TU969585 other downstream 2573068 8431531 ~ 8432041 (-) True G850763
TU969056 other downstream 3258485 7741302 ~ 7746624 (-) True G850323
TU968510 other downstream 3561492 7440903 ~ 7443617 (-) False G849864
TU973046 other upstream 436594 11442252 ~ 11442590 (-) True G853740
TU973334 other upstream 576028 11581686 ~ 11583188 (-) True LOC110533345
TU973362 other upstream 609598 11615256 ~ 11620922 (-) True G854016
TU973775 other upstream 779462 11785120 ~ 11785853 (-) True G854402
TU974134 other upstream 1288445 12294103 ~ 12294536 (-) True G854734

Expression Profile


TU972516 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU972516 Expression in each Bioproject

Bar chart with 21 bars.
TU972516 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.