RNA id: TU984231



Basic Information


Item Value
RNA id TU984231
length 262
lncRNA type inter_gene
GC content 0.50
exon number 1
gene id G864017
representative False

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 20061038 ~ 20061299 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gcaacacccacccgtagcaagcgctccggcaggtgtatctcactgatcatccctaaagccaacacctcatttggccgcctttcgttccagttctctgctgcctgtgactggaacgaattgcaaaaatcgccgaagttggagacttttatctccctcaccaacttcaaacatctgctatctgagcagctaaccgatcgctgcagctgtacatagtccatctgtaaatagcccacccaattttacctacctcatccccatactg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU984214 lncRNA upstream 11931 20048796 ~ 20049107 (+) True G864002
TU984213 lncRNA upstream 13088 20047641 ~ 20047950 (+) True G864001
TU984204 lncRNA upstream 19116 20041702 ~ 20041922 (+) True G863992
TU983833 lncRNA upstream 23802 20035223 ~ 20037236 (+) True G863675
TU983807 lncRNA upstream 69045 19991780 ~ 19991993 (+) True G863649
TU984257 lncRNA downstream 21656 20082955 ~ 20083219 (+) True G864042
TU984391 lncRNA downstream 167667 20228966 ~ 20243062 (+) True G864155
TU984302 lncRNA downstream 182275 20243574 ~ 20290283 (+) True G864069
TU984428 lncRNA downstream 222220 20283519 ~ 20285119 (+) True G864192
TU984481 lncRNA downstream 304304 20365603 ~ 20365952 (+) True G864235
XM_021617175.2 mRNA upstream 101568 19939132 ~ 19959470 (+) False LOC100136197
NM_001124473.1 mRNA upstream 101593 19939165 ~ 19959445 (+) True LOC100136197
XM_021617703.2 mRNA upstream 146538 19904704 ~ 19914500 (+) True LOC110533469
XM_021617702.2 mRNA upstream 170739 19862577 ~ 19890299 (+) False LOC110533468
XM_021617701.2 mRNA upstream 205663 19835629 ~ 19855375 (+) True LOC110533467
XM_036989863.1 mRNA downstream 59659 20120958 ~ 20270850 (+) False LOC110534862
XR_005053597.1 mRNA downstream 59661 20120960 ~ 20304813 (+) False LOC110534862
XM_036989861.1 mRNA downstream 59674 20120973 ~ 20307243 (+) False LOC110534862
XM_036989862.1 mRNA downstream 59677 20120976 ~ 20307243 (+) False LOC110534862
XM_036989860.1 mRNA downstream 59678 20120977 ~ 20307243 (+) False LOC110534862
TU983728 other upstream 192164 19863314 ~ 19868874 (+) False LOC110533468
TU983521 other upstream 543705 19515529 ~ 19517333 (+) False LOC110533458
TU983405 other upstream 644187 19416344 ~ 19416851 (+) True G863286
TU982587 other upstream 992766 19061314 ~ 19068272 (+) True cenatac
TU980845 other upstream 2561867 17495612 ~ 17499171 (+) True G860846
TU984286 other downstream 229047 20290346 ~ 20307243 (+) True LOC110534862
TU984463 other downstream 279083 20340382 ~ 20351565 (+) False G864219
TU984464 other downstream 289499 20350798 ~ 20351565 (+) True G864219
TU984868 other downstream 1009514 21070813 ~ 21083881 (+) False G864566
TU984871 other downstream 1015483 21076782 ~ 21080099 (+) True G864566

Expression Profile


TU984231 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU984231 Expression in each Bioproject

Bar chart with 14 bars.
TU984231 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.