RNA id: TU995916



Basic Information


Item Value
RNA id TU995916
length 239
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G874863
representative True

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 28822651 ~ 28822889 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctgccttacaaacaggacaacggagcggatcccatgcagcgacccaaaaaaacgactccgaaaaagagggaaacgaggcggtcttctggtcagactccggagacgagcacaccgtgcaccactccctagcattcttcttgccaatgtccagtctcttgacaacaaggttgatgaaatccgagcaagggtagcattccagagggacatcagagactgtaacgttctttgcttcacggaaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU995814 lncRNA downstream 174905 28647509 ~ 28647746 (-) True G874775
TU995813 lncRNA downstream 175337 28647084 ~ 28647314 (-) True G874774
TU995788 lncRNA downstream 177721 28644074 ~ 28644930 (-) True G874749
TU995787 lncRNA downstream 179155 28642298 ~ 28643496 (-) True G874748
TU995804 lncRNA downstream 192350 28630013 ~ 28630301 (-) True G874765
TU995928 lncRNA upstream 5784 28828673 ~ 28828931 (-) True G874875
TU996227 lncRNA upstream 70555 28893444 ~ 28893677 (-) True G875167
TU996228 lncRNA upstream 73402 28896291 ~ 28896686 (-) True G875168
TU996189 lncRNA upstream 79238 28902127 ~ 28926237 (-) False G875132
TU996191 lncRNA upstream 79238 28902127 ~ 28935126 (-) True G875132
XM_021618003.2 mRNA downstream 7147 28731803 ~ 28815504 (-) True LOC110533612
XM_021618005.2 mRNA downstream 66683 28731803 ~ 28755968 (-) False LOC110533612
XM_036990022.1 mRNA downstream 174433 28643569 ~ 28648218 (-) True arl10
XM_021617994.2 mRNA downstream 198302 28579433 ~ 28624349 (-) True LOC110533606
XM_021617993.2 mRNA downstream 262636 28549463 ~ 28560015 (-) True LOC110533605
XM_021618006.2 mRNA upstream 85502 28908391 ~ 29011524 (-) False LOC110533613
XM_021618007.2 mRNA upstream 85502 28908391 ~ 29166800 (-) True LOC110533613
XM_021618012.2 mRNA upstream 703076 29525965 ~ 29530354 (-) False cnot8
XM_021618010.2 mRNA upstream 703076 29525965 ~ 29530539 (-) True cnot8
XM_021618013.2 mRNA upstream 709041 29531930 ~ 29555366 (-) False LOC110533616
TU995737 other downstream 279384 28540229 ~ 28543267 (-) True G874706
TU994733 other downstream 1238389 27582929 ~ 27584262 (-) True G873784
TU994221 other downstream 1469405 27352393 ~ 27353246 (-) True LOC110533580
TU994124 other downstream 1658101 27162900 ~ 27164550 (-) False G873209
TU993956 other downstream 1915699 26890025 ~ 26906952 (-) True LOC110533569
TU996256 other upstream 118351 28941240 ~ 28985070 (-) True G875194
TU998135 other upstream 1092478 29915367 ~ 29916505 (-) True LOC110533621
TU1000307 other upstream 2624593 31447482 ~ 31449163 (-) True G878962
TU1000802 other upstream 3402543 32225432 ~ 32225936 (-) True G879440
TU1000800 other upstream 3424122 32247011 ~ 32249213 (-) True LOC110533652

Expression Profile


TU995916 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU995916 Expression in each Bioproject

Bar chart with 12 bars.
TU995916 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.