RNA id: TU1036806



Basic Information


Item Value
RNA id TU1036806
length 433
lncRNA type antisense_over
GC content 0.48
exon number 1
gene id G911659
representative True

Chromosome Information


Item Value
chromosome id NC_048574.1
NCBI id CM023228.2
chromosome length 87811138
location 61678054 ~ 61678486 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


CCTTTGATTGGTTCCTTATGGGGGACTTAGAGTCATGGATGTCCTTAGATATGGGTCTGGAGTGGTCCAACTCACTCTCCTCCGCTGCATCATTGTCCAATAGTATCTTCGGTTTGATGACAGCAATTGCATCAGCTCCAGTGTCATTGTTGTTGTCTACTTCCTGTTGTCTGTTGTCCGATTGGTTGTCCACAATCTCATTCGAACTTGATTGGCTGAAGTGAACATCCTCATATAAAGAATGGCCTATGTCCTCGTGGTTATGTTGAACGTCGTTGGGGAGATGCAACTCTGGTTCAGTCTTTAATTGGTCGCCTTCATCACCACCGTGTTGGCTAGCAGCCTCTGATTGGTAAACGGACAGTGAGGGGGCGGGACTGTCCTTAATGGACAGGAATGGTGACCACTCCTCTCCTGTTAGAATCTCGTCCAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1036805 lncRNA upstream 534 61677112 ~ 61677520 (+) True G911658
TU1036795 lncRNA upstream 2167 61667407 ~ 61675887 (+) False G911655
TU1036796 lncRNA upstream 2167 61667407 ~ 61675887 (+) True G911655
TU1036797 lncRNA upstream 7957 61669174 ~ 61670097 (+) True G911656
TU1036780 lncRNA upstream 51775 61626072 ~ 61626279 (+) True G911642
TU1036807 lncRNA downstream 1011 61679497 ~ 61679729 (+) True G911660
TU1036819 lncRNA downstream 24160 61702646 ~ 61702933 (+) True G911672
TU1036820 lncRNA downstream 27210 61705696 ~ 61705943 (+) True G911673
TU1036824 lncRNA downstream 30501 61708987 ~ 61709203 (+) True G911677
TU1036827 lncRNA downstream 32055 61710541 ~ 61710842 (+) True G911680
XM_021619293.2 mRNA upstream 18561 61649733 ~ 61659493 (+) False si:dkey-9i23.4
XM_021619292.2 mRNA upstream 18561 61649739 ~ 61659493 (+) False si:dkey-9i23.4
XM_036933564.1 mRNA upstream 59593 61608929 ~ 61618461 (+) False LOC110534941
XM_021619295.2 mRNA downstream 14857 61693343 ~ 61694713 (+) True tmem187
XM_021619296.2 mRNA downstream 19088 61697574 ~ 61705213 (+) True ndufs8a
XR_005034358.1 mRNA downstream 32623 61711109 ~ 61712946 (+) False LOC110534943
XR_005034359.1 mRNA downstream 32623 61711109 ~ 61712946 (+) False LOC110534943
XM_021619299.2 mRNA downstream 46679 61725165 ~ 61736061 (+) False LOC110534440
TU1036737 other upstream 18554 61649757 ~ 61659500 (+) True si:dkey-9i23.4
TU1036791 other upstream 19628 61657327 ~ 61658426 (+) True G911652
TU1036742 other upstream 108992 61566357 ~ 61569062 (+) True G911611
TU1036460 other upstream 495784 61181749 ~ 61182270 (+) False LOC110533174
TU1036461 other upstream 495846 61181749 ~ 61182208 (+) False LOC110533174
TU1036814 other downstream 12783 61691269 ~ 61691638 (+) True G911667
TU1037247 other downstream 559491 62237977 ~ 62335475 (+) True G912025
TU1037122 other downstream 767124 62445610 ~ 62448810 (+) True LOC110534674
TU1037210 other downstream 857970 62536456 ~ 62562633 (+) False LOC110534616
TU1037138 other downstream 862314 62540800 ~ 62591739 (+) True G911920

Expression Profile


TU1036806 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU1036806 Expression in each Bioproject

Bar chart with 10 bars.
TU1036806 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 16.
End of interactive chart.