RNA id: TU1064363



Basic Information


Item Value
RNA id TU1064363
length 312
lncRNA type intronic
GC content 0.42
exon number 2
gene id G933585
representative False

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 584393 ~ 589797 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


tcactgtttctttatgaacaggtgtgtgggtactgtcactgtttctttatgaacaggtgtgtgggtactatcactgtttctttatgaacaggtgtgtgggtactgtcactgtgtctttatgaacaggtgtgtgggtactatcactgtttctttatgaacaggtatgtgggttcctgtcactgtttctttatgaacaggtgtgtgggtactgtcactgtttctttatgaacaggtatgtgggtactgtcactgtgtctttatgaacaggtgtgtgggtactatcactgtttctttatgaacaggtatgtgggt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1064334 lncRNA upstream 5742 532308 ~ 578651 (+) True G933560
TU1064303 lncRNA upstream 17038 544579 ~ 567355 (+) True G933533
TU1064301 lncRNA upstream 21734 539980 ~ 562659 (+) False G933532
TU1064325 lncRNA upstream 60775 518896 ~ 523618 (+) True G933552
TU1064318 lncRNA upstream 72620 508049 ~ 511773 (+) True G933545
TU1064366 lncRNA downstream 14881 604678 ~ 608464 (+) True G933586
TU1064353 lncRNA downstream 20660 610457 ~ 611537 (+) True G933576
TU1064426 lncRNA downstream 23467 613264 ~ 613590 (+) True G933635
TU1064427 lncRNA downstream 23960 613757 ~ 614019 (+) True G933636
TU1064430 lncRNA downstream 26625 616422 ~ 616648 (+) True G933639
XM_036936628.1 mRNA upstream 19817 561434 ~ 564576 (+) True LOC118937458
XM_021620013.2 mRNA upstream 42040 485692 ~ 542353 (+) False LOC110535152
XM_036934642.1 mRNA upstream 145863 392130 ~ 438530 (+) False slc22a13b
XM_036934643.1 mRNA upstream 148934 392112 ~ 435459 (+) False slc22a13b
XM_036934640.1 mRNA upstream 206030 340641 ~ 378363 (+) True cry-dash
XM_021620012.2 mRNA downstream 42326 632123 ~ 646961 (+) True LOC110535151
XM_036934648.1 mRNA downstream 152695 742492 ~ 859531 (+) False LOC110535150
XM_036934649.1 mRNA downstream 152695 742492 ~ 859531 (+) False LOC110535150
XM_036934650.1 mRNA downstream 152695 742492 ~ 859531 (+) False LOC110535150
XM_036934651.1 mRNA downstream 239691 829488 ~ 859531 (+) True LOC110535150
TU1064302 other upstream 21734 561653 ~ 562659 (+) False G933532
TU1064300 other upstream 21734 562014 ~ 562659 (+) True G933532
TU1064305 other upstream 44981 485830 ~ 539412 (+) True LOC110535152
TU1064355 other downstream 6526 596323 ~ 604169 (+) True LOC110536523
TU1064476 other downstream 135390 725187 ~ 728205 (+) True G933679
TU1064658 other downstream 359734 949531 ~ 951584 (+) True G933799
TU1065095 other downstream 717730 1307527 ~ 1307759 (+) True G934169
TU1065194 other downstream 898279 1488076 ~ 1496014 (+) False G934256

Expression Profile


TU1064363 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU1064363 Expression in each Bioproject

Bar chart with 13 bars.
TU1064363 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.