RNA id: TU1066446



Basic Information


Item Value
RNA id TU1066446
length 295
lncRNA type inter_gene
GC content 0.49
exon number 1
gene id G935252
representative True

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 2679989 ~ 2680283 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ggaggactctctaaacagagaacatccctggtcatcactactgcctctgatctggaggactcactaaacagagaacatccctggtcatccctactgcctctgatctggaggactcactaaacagagaacatccctggtcatccttactgcctctgatctggaggactcactaaacagagaacatccctggtcatccctactgcctctgatctggaggactcactaaacagagaacatccctggtcatccctactgtctctgatctgtaggactcactaaacagagaacatccctg

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1066442 lncRNA upstream 14535 2665210 ~ 2665454 (+) True G935248
TU1066440 lncRNA upstream 15089 2664341 ~ 2664900 (+) True G935246
TU1066438 lncRNA upstream 15961 2663655 ~ 2664028 (+) True G935244
TU1066425 lncRNA upstream 26602 2653182 ~ 2653387 (+) True G935231
TU1066415 lncRNA upstream 33738 2646023 ~ 2646251 (+) True G935221
TU1066477 lncRNA downstream 19935 2700218 ~ 2700457 (+) True G935265
TU1066479 lncRNA downstream 20417 2700700 ~ 2700931 (+) True G935267
TU1066498 lncRNA downstream 33683 2713966 ~ 2714210 (+) True G935284
TU1066519 lncRNA downstream 50319 2730602 ~ 2762438 (+) True G935300
TU1066579 lncRNA downstream 102901 2783184 ~ 2783542 (+) True G935356
XM_036934659.1 mRNA upstream 149015 2419346 ~ 2530974 (+) False plod2
XM_036934661.1 mRNA upstream 149015 2419346 ~ 2530974 (+) False plod2
XM_036934660.1 mRNA upstream 150329 2419339 ~ 2529660 (+) False plod2
XM_036934658.1 mRNA upstream 292397 2376701 ~ 2387592 (+) True si:ch73-206p6.1
XM_021620030.2 mRNA upstream 824420 1843164 ~ 1855569 (+) False LOC110535167
XR_005034533.1 mRNA downstream 567543 3247826 ~ 3249391 (+) False LOC118937290
XR_005034785.1 mRNA downstream 721769 3402052 ~ 3402867 (+) True LOC118937434
XM_021620035.2 mRNA downstream 843274 3523557 ~ 3616312 (+) False jph1a
XM_036934667.1 mRNA downstream 843274 3523557 ~ 3616312 (+) True jph1a
XM_021620039.2 mRNA downstream 953657 3633940 ~ 3636886 (+) True LOC110535177
TU1065679 other upstream 770909 1908660 ~ 1909080 (+) True G934640
TU1065592 other upstream 852623 1826627 ~ 1827366 (+) True G934579
TU1065194 other upstream 1183975 1488076 ~ 1496014 (+) False G934256
TU1065095 other upstream 1372230 1307527 ~ 1307759 (+) True G934169
TU1064658 other upstream 1728405 949531 ~ 951584 (+) True G933799
TU1067186 other downstream 869756 3550039 ~ 3550487 (+) True G935846
TU1067342 other downstream 1300488 3980771 ~ 3981151 (+) True G935976
TU1067343 other downstream 1301568 3981851 ~ 3982198 (+) True G935977
TU1068725 other downstream 2339622 5019905 ~ 5021613 (+) False G937051
TU1068724 other downstream 2339877 5020160 ~ 5028145 (+) True G937051

Expression Profile


TU1066446 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1066446 Expression in each Bioproject

Bar chart with 18 bars.
TU1066446 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.