RNA id: TU1072401



Basic Information


Item Value
RNA id TU1072401
length 285
lncRNA type intronic
GC content 0.44
exon number 1
gene id G940281
representative True

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 8474695 ~ 8474979 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


agtgatggcagcacacatagttatattacccccacgctgtccagggacattggtaattgccctctgtcctattacatatcttccgcggcgcctggttttggtgaggttgaagccaacctcatccacataaataaattaatggcgaattacatgggcatccagctccaatactctctgtaacagacaaaaaggatatacagatgtatggtatgtctgaagtactggaagtagtgttgcatacatacctctacaaagtcatgtcgcatattcttgactctgtcagag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1072397 lncRNA upstream 11286 8463111 ~ 8463409 (+) True G940277
TU1072396 lncRNA upstream 12365 8462035 ~ 8462330 (+) True G940276
TU1072395 lncRNA upstream 12727 8461762 ~ 8461968 (+) True G940275
TU1072387 lncRNA upstream 16141 8458232 ~ 8458554 (+) True G940267
TU1072386 lncRNA upstream 16841 8457499 ~ 8457854 (+) True G940266
TU1072411 lncRNA downstream 15160 8490139 ~ 8495216 (+) True LOC110536544
TU1072424 lncRNA downstream 28006 8502985 ~ 8507380 (+) False G940297
TU1072420 lncRNA downstream 29239 8504218 ~ 8507380 (+) False G940297
TU1072422 lncRNA downstream 29239 8504218 ~ 8507380 (+) True G940297
TU1072448 lncRNA downstream 38026 8513005 ~ 8573520 (+) True G940303
XM_036936634.1 mRNA upstream 137055 8294346 ~ 8337640 (+) True LOC118937462
XM_021620079.2 mRNA upstream 248657 8195607 ~ 8226038 (+) False LOC110535212
XM_036936611.1 mRNA upstream 298910 8174793 ~ 8175785 (+) True LOC118937436
XR_005034786.1 mRNA upstream 300670 8171872 ~ 8174025 (+) True LOC110536601
XM_021620072.1 mRNA upstream 502884 7969927 ~ 7971811 (+) True LOC110535207
XM_036934764.1 mRNA downstream 175459 8650438 ~ 8685656 (+) True LOC110535213
XR_002475217.2 mRNA downstream 324561 8799540 ~ 8802257 (+) False LOC110535219
XR_005034543.1 mRNA downstream 324561 8799540 ~ 8802257 (+) False LOC110535219
LOC118937463 mRNA downstream 370586 8845565 ~ 8855476 (+) False LOC118937463
XM_021620091.2 mRNA downstream 382127 8857106 ~ 8860218 (+) True LOC110535221
TU1072364 other upstream 34920 8439480 ~ 8439775 (+) True G940247
TU1072200 other upstream 93115 8379847 ~ 8381580 (+) False LOC110536544
TU1072090 other upstream 95367 8196368 ~ 8379328 (+) True LOC110535212
TU1072199 other upstream 96767 8374506 ~ 8377928 (+) True G940102
TU1071752 other upstream 334112 8140266 ~ 8140583 (+) True G939690
TU1072470 other downstream 57561 8532540 ~ 8540867 (+) True G940313
TU1072537 other downstream 176525 8651504 ~ 8652521 (+) False G940376
TU1072646 other downstream 377515 8852494 ~ 8855437 (+) True LOC118937463
TU1074217 other downstream 1770130 10245109 ~ 10245506 (+) True G941893
TU1075144 other downstream 2635747 11110726 ~ 11111336 (+) True G942702

Expression Profile


TU1072401 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU1072401 Expression in each Bioproject

Bar chart with 14 bars.
TU1072401 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.