RNA id: TU1072470



Basic Information


Item Value
RNA id TU1072470
length 292
RNA type TUCP
GC content 0.41
exon number 2
gene id G940313
representative True

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 8532540 ~ 8540867 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctgatggagtctgcaaaagacctgagactgggacagagatttgtcttccaacaagacaatgatccaaaacataaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatgtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaacattttcagtctctcgatgtgcaaaactgatagagacatacccc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1072424 lncRNA upstream 25160 8502985 ~ 8507380 (+) False G940297
TU1072420 lncRNA upstream 25160 8504218 ~ 8507380 (+) False G940297
TU1072422 lncRNA upstream 25160 8504218 ~ 8507380 (+) True G940297
TU1072411 lncRNA upstream 37324 8490139 ~ 8495216 (+) True LOC110536544
TU1072401 lncRNA upstream 57561 8474695 ~ 8474979 (+) True G940281
TU1072510 lncRNA downstream 66548 8607415 ~ 8607781 (+) True G940350
TU1072515 lncRNA downstream 71947 8612814 ~ 8615576 (+) True G940355
TU1072538 lncRNA downstream 110637 8651504 ~ 8652993 (+) True G940376
TU1072568 lncRNA downstream 161569 8702436 ~ 8736722 (+) True G940402
TU1072543 lncRNA downstream 170044 8710911 ~ 8743124 (+) False G940379
XM_036934763.1 mRNA upstream 35520 8381370 ~ 8497020 (+) False LOC110536544
XM_036936634.1 mRNA upstream 194900 8294346 ~ 8337640 (+) True LOC118937462
XM_021620079.2 mRNA upstream 306502 8195607 ~ 8226038 (+) False LOC110535212
XM_036936611.1 mRNA upstream 356755 8174793 ~ 8175785 (+) True LOC118937436
XR_005034786.1 mRNA upstream 358515 8171872 ~ 8174025 (+) True LOC110536601
XM_036934764.1 mRNA downstream 109571 8650438 ~ 8685656 (+) True LOC110535213
XR_002475217.2 mRNA downstream 258673 8799540 ~ 8802257 (+) False LOC110535219
XR_005034543.1 mRNA downstream 258673 8799540 ~ 8802257 (+) False LOC110535219
LOC118937463 mRNA downstream 304698 8845565 ~ 8855476 (+) False LOC118937463
XM_021620091.2 mRNA downstream 316239 8857106 ~ 8860218 (+) True LOC110535221
TU1072364 other upstream 92765 8439480 ~ 8439775 (+) True G940247
TU1072200 other upstream 150960 8379847 ~ 8381580 (+) False LOC110536544
TU1072090 other upstream 153212 8196368 ~ 8379328 (+) True LOC110535212
TU1072199 other upstream 154612 8374506 ~ 8377928 (+) True G940102
TU1071752 other upstream 391957 8140266 ~ 8140583 (+) True G939690
TU1072537 other downstream 110637 8651504 ~ 8652521 (+) False G940376
TU1072646 other downstream 311627 8852494 ~ 8855437 (+) True LOC118937463
TU1074217 other downstream 1704242 10245109 ~ 10245506 (+) True G941893
TU1075144 other downstream 2569859 11110726 ~ 11111336 (+) True G942702
TU1077607 other downstream 4846683 13387550 ~ 13394875 (+) True G944957

Expression Profile


TU1072470 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU1072470 Expression in each Bioproject

Bar chart with 19 bars.
TU1072470 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.