RNA id: TU1112336



Basic Information


Item Value
RNA id TU1112336
length 264
lncRNA type inter_gene
GC content 0.43
exon number 1
gene id G976733
representative True

Chromosome Information


Item Value
chromosome id NC_048575.1
NCBI id CM023229.2
chromosome length 86280908
location 39692863 ~ 39693126 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ttattattttggtcaggccagggtgtgacatgggtttattatgtggtgtgttttgtcttggggtttttgtaggtattgggattgtggtatagtggggttgtctagaatagtctatggctgtctggagtggttctcaatcagaggcaggtgtttatcgttgtctctgattgggaaccatatttaggcagccgtattctttgagtgtttcgtgggtgattgttcctgtctcagtgtttgtttgcaccagaataggctgtttaggtt

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1112325 lncRNA upstream 18234 39674362 ~ 39674629 (+) True G976722
TU1112322 lncRNA upstream 21228 39671429 ~ 39671635 (+) True G976719
TU1112317 lncRNA upstream 25526 39667070 ~ 39667337 (+) True G976714
TU1111971 lncRNA upstream 58261 39634368 ~ 39634602 (+) True G976396
TU1111958 lncRNA upstream 83098 39609432 ~ 39609765 (+) True G976383
TU1112521 lncRNA downstream 106554 39799680 ~ 39799892 (+) True G976911
TU1112533 lncRNA downstream 114672 39807798 ~ 39808057 (+) True G976922
TU1112536 lncRNA downstream 115783 39808909 ~ 39809141 (+) True G976925
TU1112546 lncRNA downstream 120939 39814065 ~ 39814607 (+) True G976935
TU1112587 lncRNA downstream 155968 39849094 ~ 39849410 (+) True G976960
XR_005034793.1 mRNA upstream 32613 39657610 ~ 39660250 (+) True LOC118937443
XR_005034792.1 mRNA upstream 35866 39655631 ~ 39656997 (+) True LOC118937442
LOC110535016 mRNA upstream 59711 39626969 ~ 39633152 (+) True LOC110535016
XM_036935454.1 mRNA upstream 172097 39482495 ~ 39520766 (+) False LOC110535687
XM_036935458.1 mRNA downstream 1784 39694910 ~ 39787287 (+) False LOC110535018
XM_036935457.1 mRNA downstream 1785 39694911 ~ 39787287 (+) False LOC110535018
XM_036935460.1 mRNA downstream 1785 39694911 ~ 39787287 (+) False LOC110535018
XM_036935461.1 mRNA downstream 1785 39694911 ~ 39787287 (+) False LOC110535018
XM_036935462.1 mRNA downstream 1785 39694911 ~ 39787287 (+) False LOC110535018
TU1111560 other upstream 634852 39057676 ~ 39058011 (+) True G976017
TU1109485 other upstream 1629763 38057798 ~ 38063100 (+) True G974184
TU1109353 other upstream 1649533 38042706 ~ 38043330 (+) False LOC110535015
TU1109354 other upstream 1654152 38020449 ~ 38038711 (+) False LOC110535015
TU1109337 other upstream 1857528 37831521 ~ 37835335 (+) True lztfl1
TU1113929 other downstream 1074710 40767836 ~ 40768229 (+) True G978255
TU1114082 other downstream 1309950 41003076 ~ 41016088 (+) True G978396
TU1115468 other downstream 2385366 42078492 ~ 42078855 (+) True G979689
TU1115777 other downstream 2835394 42528520 ~ 42533308 (+) True G979965
TU1115850 other downstream 2938698 42631824 ~ 42636709 (+) False G980019

Expression Profile


TU1112336 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU1112336 Expression in each Bioproject

Bar chart with 18 bars.
TU1112336 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.