RNA id: TU1178830



Basic Information


Item Value
RNA id TU1178830
length 357
lncRNA type inter_gene
GC content 0.39
exon number 2
gene id G1034644
representative True

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 8231276 ~ 8232542 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atctatctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggtcgatgtgttattctagcctgtctatctataggtaacagggtcgatgtgttattctagcctgtctatctataggtaacagggttgatgtgttattctagcctgtctatctataggtaacagggttga

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1178794 lncRNA downstream 4769 8225918 ~ 8226507 (-) True G1034610
TU1178798 lncRNA downstream 107120 8123281 ~ 8124156 (-) True G1034614
TU1178735 lncRNA downstream 130917 8099689 ~ 8100359 (-) True G1034561
TU1178767 lncRNA downstream 157336 8073670 ~ 8073940 (-) True G1034592
TU1178740 lncRNA downstream 191686 8039255 ~ 8039590 (-) True G1034566
TU1178836 lncRNA upstream 11121 8243663 ~ 8244337 (-) True G1034649
TU1178845 lncRNA upstream 23250 8255792 ~ 8257078 (-) True G1034655
TU1178843 lncRNA upstream 23684 8256226 ~ 8256848 (-) True G1034654
TU1178685 lncRNA upstream 74485 8307027 ~ 8307650 (-) True G1034522
TU1178893 lncRNA upstream 132504 8365046 ~ 8369169 (-) True G1034696
XM_036936811.1 mRNA downstream 25883 8127848 ~ 8205393 (-) True LOC110536914
XM_036936810.1 mRNA downstream 25884 8127848 ~ 8205392 (-) False LOC110536914
XM_036936812.1 mRNA downstream 31836 8127848 ~ 8199440 (-) False LOC110536914
XM_021622585.2 mRNA downstream 250073 7978843 ~ 7981203 (-) True LOC110536909
XM_021622583.2 mRNA downstream 330361 7899626 ~ 7900915 (-) False LOC101268972
NM_001124579.2 mRNA upstream 13468 8246010 ~ 8252914 (-) True LOC100136343
XR_005034853.1 mRNA upstream 45999 8278541 ~ 8288538 (-) True LOC118937621
XM_036936816.1 mRNA upstream 59009 8291551 ~ 8460670 (-) False ptpn13
XM_036936814.1 mRNA upstream 59009 8291551 ~ 8460671 (-) False ptpn13
XM_036936815.1 mRNA upstream 59009 8291551 ~ 8460671 (-) True ptpn13
TU1178568 other downstream 396698 7827880 ~ 7834578 (-) True G1034443
TU1178484 other downstream 449238 7721252 ~ 7782038 (-) True LOC110523118
TU1176586 other downstream 2030942 6197017 ~ 6200334 (-) True G1032941
TU1175815 other downstream 2447912 5782940 ~ 5783364 (-) True G1032314
TU1175654 other downstream 2686768 5538381 ~ 5544508 (-) True LOC110536877
TU1178862 other upstream 46797 8279339 ~ 8279866 (-) True G1034667
TU1179454 other upstream 603714 8836256 ~ 8838834 (-) True G1035160
TU1179584 other upstream 785965 9018507 ~ 9042680 (-) False hcn1
TU1179583 other upstream 805045 9037587 ~ 9042680 (-) False hcn1
TU1179591 other upstream 805045 9037587 ~ 9042680 (-) False hcn1

Expression Profile


TU1178830 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

TU1178830 Expression in each Bioproject

Bar chart with 10 bars.
TU1178830 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.