RNA id: TU1187250



Basic Information


Item Value
RNA id TU1187250
length 293
lncRNA type inter_gene
GC content 0.37
exon number 1
gene id G1041831
representative True

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 14877244 ~ 14877536 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TCTGCTGGGAAACTGAAACTTATATTTCACCCTGAGTTCCCTTTTTATCTTCCCTGTGTTACATTCCTCCTAATGGATGTAGGAGCTATATAAATAGGATGACGAAAATGAACAAATCCCCTCAGACCACAACAATGTGAAAGTACACTTAAGGGAATGTCCGTTCCAGTAAATATCTTTCTGTATTTAAACTTGGAATCTGCCTTCTATGTCCTGTATGACTATCATTGGCCAATGCTGTAGTGTATTGATGTGGACAATAATTACACTTAATTAAATGTTATACCATCCAT

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1186436 lncRNA downstream 16118 14860617 ~ 14861126 (-) True G1041138
TU1186430 lncRNA downstream 20346 14856671 ~ 14856898 (-) True G1041132
TU1186429 lncRNA downstream 20966 14856052 ~ 14856278 (-) True G1041131
TU1186343 lncRNA downstream 83056 14793947 ~ 14794188 (-) True G1041049
TU1186342 lncRNA downstream 85207 14791828 ~ 14792037 (-) True G1041048
TU1187281 lncRNA upstream 62256 14939792 ~ 14941546 (-) True G1041859
TU1187288 lncRNA upstream 70948 14948484 ~ 14948692 (-) True G1041866
TU1187293 lncRNA upstream 76213 14953749 ~ 14953986 (-) True G1041871
TU1187317 lncRNA upstream 115224 14992760 ~ 15038648 (-) True G1041895
TU1187362 lncRNA upstream 175688 15053224 ~ 15138711 (-) False G1041932
NM_001124403.2 mRNA downstream 1672 14869739 ~ 14875572 (-) True c3ar1
XM_021622729.2 mRNA downstream 45699 14829621 ~ 14831545 (-) True LOC110537020
XM_021622725.2 mRNA downstream 624296 14249910 ~ 14252948 (-) True tdgf1
XM_021622713.2 mRNA downstream 663668 14198158 ~ 14213576 (-) False zmp:0000001301
XM_021622716.2 mRNA downstream 663668 14198158 ~ 14213576 (-) True zmp:0000001301
XM_021622735.2 mRNA upstream 18812 14896348 ~ 14946975 (-) False LOC110537021
XM_021622732.2 mRNA upstream 19863 14897399 ~ 14935093 (-) False LOC110537021
XM_021622730.2 mRNA upstream 19863 14897399 ~ 14935321 (-) False LOC110537021
XM_021622731.2 mRNA upstream 19863 14897399 ~ 14936004 (-) False LOC110537021
XM_021622733.2 mRNA upstream 19863 14897399 ~ 14936078 (-) False LOC110537021
TU1185711 other downstream 566192 14307600 ~ 14311052 (-) True G1040432
TU1185574 other downstream 697103 14178658 ~ 14180141 (-) True G1040300
TU1184637 other downstream 1521449 13355300 ~ 13355795 (-) True G1039504
TU1184605 other downstream 1554528 13321210 ~ 13322716 (-) True LOC110536986
TU1184467 other downstream 1724937 13151021 ~ 13152307 (-) True G1039366
TU1187996 other upstream 1226627 16104163 ~ 16104883 (-) True G1042500
TU1188176 other upstream 1447427 16324963 ~ 16328114 (-) False LOC110537059
TU1188178 other upstream 1447427 16324963 ~ 16328114 (-) True LOC110537059
TU1188573 other upstream 1656081 16533617 ~ 16544726 (-) True LOC110537061
TU1189216 other upstream 2187785 17065321 ~ 17067885 (-) False LOC110537077

Expression Profile


TU1187250 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.
End of interactive chart.

TU1187250 Expression in each Bioproject

Bar chart with 15 bars.
TU1187250 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 20.
End of interactive chart.