RNA id: TU1263945



Basic Information


Item Value
RNA id TU1263945
length 230
lncRNA type inter_gene
GC content 0.54
exon number 1
gene id G1111731
representative True

Chromosome Information


Item Value
chromosome id NC_048576.1
NCBI id CM023230.2
chromosome length 102853256
location 75286712 ~ 75286941 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


acacttatgtgactacagctcagctacagctcagcgttcaacaccatagtaccctcaaagctcatcactaagctaaggatcctgggactaaacacatccctctgcaactggatcctggacttcctgacgggctgcccccaggtggtgagggtaggtagcaacacatctgccacgctgatcctcaacactggagctccccaagtgtgcgtgctcagtcccctcctgttcac

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1263940 lncRNA downstream 5704 75279160 ~ 75281008 (-) True G1111726
TU1263939 lncRNA downstream 10768 75275510 ~ 75275944 (-) True G1111725
TU1263941 lncRNA downstream 11607 75274873 ~ 75275105 (-) True G1111727
TU1263938 lncRNA downstream 13705 75272780 ~ 75273007 (-) True G1111724
TU1263937 lncRNA downstream 15167 75271329 ~ 75271545 (-) True G1111723
TU1263951 lncRNA upstream 1177 75288118 ~ 75293471 (-) True LOC110538381
TU1264891 lncRNA upstream 122512 75409453 ~ 75428071 (-) True G1112517
TU1264933 lncRNA upstream 201004 75487945 ~ 75491023 (-) True G1112553
TU1264943 lncRNA upstream 242420 75529361 ~ 75529671 (-) True G1112562
TU1264944 lncRNA upstream 242876 75529817 ~ 75530104 (-) True G1112563
XR_002475747.2 mRNA downstream 68736 75217568 ~ 75217976 (-) False LOC110538387
XM_021625182.2 mRNA downstream 173413 75104470 ~ 75113299 (-) True LOC110538389
XM_021625181.2 mRNA downstream 173423 75104470 ~ 75113289 (-) False LOC110538389
XM_021625184.2 mRNA downstream 346594 74939090 ~ 74940118 (-) True LOC110538392
XM_036938416.1 mRNA downstream 349656 74837505 ~ 74937056 (-) False LOC110538394
XM_036938431.1 mRNA upstream 5004 75291945 ~ 75366262 (-) False LOC110538381
XM_036938432.1 mRNA upstream 5004 75291945 ~ 75366262 (-) False LOC110538381
XM_036938433.1 mRNA upstream 5004 75291945 ~ 75366262 (-) False LOC110538381
XM_021625161.2 mRNA upstream 144608 75431549 ~ 75434649 (-) True desi1a
XM_021625150.2 mRNA upstream 178146 75465087 ~ 75500135 (-) False LOC110538375
TU1263884 other downstream 96281 75190185 ~ 75190431 (-) True G1111672
TU1263648 other downstream 405905 74880498 ~ 74880807 (-) True G1111451
TU1263616 other downstream 462122 74817975 ~ 74824590 (-) True G1111424
TU1263089 other downstream 635949 74650283 ~ 74650763 (-) True G1110941
TU1262811 other downstream 1081521 74204221 ~ 74205191 (-) True G1110701
TU1265090 other upstream 509509 75796450 ~ 75796798 (-) True G1112697
TU1265447 other upstream 1093987 76380928 ~ 76381727 (-) True G1112997
TU1265467 other upstream 1125999 76412940 ~ 76414211 (-) True G1113013
TU1265478 other upstream 1141607 76428548 ~ 76433570 (-) True LOC110538323
TU1265503 other upstream 1197431 76484372 ~ 76485285 (-) True G1113043

Expression Profile


TU1263945 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

TU1263945 Expression in each Bioproject

Bar chart with 20 bars.
TU1263945 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.