RNA id: TCONS_00041242


Basic Information

Item Value
RNA id TCONS_00041242
length 891
RNA type mRNA
GC content 0.54
exon number 7
gene id XLOC_020967
representative True

Chromosome Information

Item Value
chromosome id NC_007133.7
NCBI id CM002906.2
chromosome length 39133080
location 12094484 ~ 12161095 (-)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence

TCTGAACGGCTCCCCGGCAGTGCGCGCCTTCTCCGCTCGCGTCCAGGTGTGACATTTTTCGGATGCTTCTAGACATTTGAACCCGGGCCCCAATCATCATGACGGACTCCTCCTCTGCCTCTGACCCCACGGCCGGTCCTGTAGACCCCGGTCCCGCTCCTTCTGCCCCGGATCCAGCTCTGGAGGATCCAGCATCGACTCCCGCCAACGGACACCATCCGAATCAAGCGGACAGTTTTAACATGGAGCAGCAGATGAAGATCGGGGAGCCGGAGGATAACGGGCTCCTGGAGAGCAGCATGCGGCTCAAACCCCATGAGGCCCAAAGCTACAGAAAAAAAGCACTATGGGTGTCGTGGGTCTCCATTGTGGTGACGATGATCTTGGCGATCGCTGCGTTCACTGTTTCTATAATGCGGCATAGTGCGTCAGCATTTGGGTTTGCATTTGACGCCACACTGGATGTCCTGTCCTCCATTATTGTGCTTTGGCGATACAGTAATGCTGCAGCCGTTCATTCAGCACACAGAGAATACATAGCATGTGTTATCCTTGGGGTCGTCTTCATCCTGTCGGCCATAACAATCTTGGTGAAAGCCATCCATGATCTTGCCACAAAACTGGAACCAGAAGTGGATGATTTCCTCTACAGCGTGTCTGTGATCAGTGGGGTGGTCTGCACGGTTCTGTGTGTCTGCAAGTTCATGCTGGGTAAAGTTCTGACCAGCAGAGCCCTCATCACTGACGGGTTTAACTCCCTGGTTGGAGGAGTGATGGGTTTCTCCATCCTGATCAGCGCAGAGGTGTTCAAACACGAGCCTAGCGTCTGGTTTCTGGACGGCACCATCGGCATCCTCATCGGCCTCATCATTCTGGCCTACGGAGTCAAGT

Function

GO:

id name namespace
GO:0099180 zinc ion import into synaptic vesicle biological_process
GO:0055085 transmembrane transport biological_process
GO:0006812 cation transport biological_process
GO:0030285 integral component of synaptic vesicle membrane cellular_component
GO:0016020 membrane cellular_component
GO:0016021 integral component of membrane cellular_component
GO:0008270 zinc ion binding molecular_function
GO:0008324 cation transmembrane transporter activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-091204-410 Predicted to enable zinc ion binding activity. Predicted to act upstream of or within transmembrane transport and zinc ion transport. Predicted to be located in early endosome membrane and synapse. Predicted to be integral component of membrane. Predicted to be active in membrane. Predicted to be integral component of synaptic vesicle membrane. Orthologous to human TMEM163 (transmembrane protein 163).

Ensembl:

ensembl_id ENSDART00000128176

JBrowse2

Neighbor

RNA id RNA type direction distance location representative gene id
TCONS_00042352 lncRNA downstream 401750 11697272 ~ 11698675 (-) True XLOC_020962
TCONS_00042351 lncRNA downstream 426004 11672189 ~ 11674421 (-) True XLOC_020961
TCONS_00041221 lncRNA downstream 485472 11606092 ~ 11614953 (-) False XLOC_020957
TCONS_00041222 lncRNA downstream 485472 11609430 ~ 11614953 (-) True XLOC_020957
TCONS_00042350 lncRNA downstream 996154 11102905 ~ 11104271 (-) True XLOC_020951
TCONS_00041248 lncRNA upstream 444020 12604318 ~ 12609544 (-) False XLOC_020970
TCONS_00042353 lncRNA upstream 444020 12604318 ~ 12611301 (-) False XLOC_020970
TCONS_00041254 lncRNA upstream 464188 12624486 ~ 12626063 (-) True XLOC_020970
TCONS_00041257 lncRNA upstream 538823 12699121 ~ 12700988 (-) False XLOC_020972
TCONS_00042354 lncRNA upstream 617591 12777889 ~ 12786441 (-) True XLOC_020975
TCONS_00041238 mRNA downstream 144518 11898661 ~ 11955907 (-) False XLOC_020966
TCONS_00041239 mRNA downstream 145564 11898852 ~ 11954861 (-) True XLOC_020966
TCONS_00041235 mRNA downstream 267091 11778053 ~ 11833334 (-) False XLOC_020965
TCONS_00041236 mRNA downstream 267108 11781036 ~ 11833317 (-) False XLOC_020965
TCONS_00041237 mRNA downstream 270989 11815906 ~ 11829436 (-) True XLOC_020965
TCONS_00041244 mRNA upstream 57622 12217920 ~ 12337781 (-) False XLOC_020968
TCONS_00041243 mRNA upstream 57622 12217920 ~ 12337781 (-) False XLOC_020968
TCONS_00041245 mRNA upstream 120158 12280456 ~ 12304591 (-) True XLOC_020968
TCONS_00041247 mRNA upstream 444004 12604302 ~ 12626105 (-) False XLOC_020970
TCONS_00041250 mRNA upstream 444119 12604417 ~ 12626207 (-) False XLOC_020970
TCONS_00041199 other downstream 1336378 10763933 ~ 10764047 (-) True XLOC_020940
TCONS_00041196 other downstream 1432451 10667858 ~ 10667974 (-) True XLOC_020936
TCONS_00041173 other downstream 1942319 10156402 ~ 10158106 (-) True XLOC_020918
TCONS_00041160 other downstream 2020756 10076578 ~ 10079669 (-) False XLOC_020914
TCONS_00041139 other downstream 2273956 9824521 ~ 9826469 (-) True XLOC_020903
TCONS_00041246 other upstream 424541 12584839 ~ 12584954 (-) True XLOC_020969
TCONS_00041251 other upstream 447035 12607333 ~ 12611301 (-) False XLOC_020970
TCONS_00041252 other upstream 456851 12617149 ~ 12626105 (-) False XLOC_020970
TCONS_00041253 other upstream 463968 12624266 ~ 12626079 (-) False XLOC_020970
TCONS_00041266 other upstream 773187 12933485 ~ 12934589 (-) False XLOC_020979

Expression Profile

//