RNA id: TCONS_00042733



Basic Information


Item Value
RNA id TCONS_00042733
length 320
lncRNA type retained_intron
GC content 0.42
exon number 2
gene id XLOC_021504
representative True

Chromosome Information


Item Value
chromosome id NC_007134.7
NCBI id CM002907.2
chromosome length 46223584
location 10805188 ~ 10827419 (+)
genome version GRCz11_2017_zebrafish_Genome
species zebrafish
(Danio rerio)

Sequence


GGTCAGTTGTGTGTATCCTACCTCAGAGTGAGTGAACCTTTCTTTGTTGTATTTTCCGGTTTATTGAGTGGGATTTCAATATCAGCTTTCGTCCAACCATTCTGATTTCCTTAATTCTACCATTCATCATTTTTTACAGGAAAAAAGGGTCAAGTTGTGTGAACCGAATGAATGGTGTCATGTTTCCTGGCAACACTTCAGCTTTTCCAGATAGAAATGTGAATGGTCCGGGAACACCAAGGCCACTGAATAGACCAAAACACTCCTTATCCAGCAATGTAGCTACAAACGGCCTTCCTGACAGCACAGAAAGCAAAGAA

Function


GO:

id name namespace
GO:0006470 protein dephosphorylation biological_process
GO:0005634 nucleus cellular_component
GO:0030289 protein phosphatase 4 complex cellular_component
GO:0005737 cytoplasm cellular_component
GO:0019888 protein phosphatase regulator activity molecular_function

KEGG: NA

ZFIN:

id description
ZDB-GENE-030131-4922 Predicted to enable protein phosphatase regulator activity. Predicted to be involved in protein dephosphorylation. Predicted to be part of protein phosphatase 4 complex. Predicted to be active in cytoplasm and nucleus. Orthologous to human PPP4R2 (protein phosphatase 4 regulatory subunit 2).

Ensembl:

ensembl_id ENSDART00000132421

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TCONS_00042721 lncRNA upstream 657502 10146614 ~ 10156528 (+) True XLOC_021498
TCONS_00044783 lncRNA upstream 861204 9938245 ~ 9952826 (+) False XLOC_021497
TCONS_00044785 lncRNA upstream 861204 9938274 ~ 9952826 (+) False XLOC_021497
TCONS_00044784 lncRNA upstream 861204 9938274 ~ 9952826 (+) True XLOC_021497
TCONS_00044658 lncRNA upstream 948092 9865701 ~ 9865938 (+) True XLOC_021495
TCONS_00044786 lncRNA downstream 409627 11224124 ~ 11224605 (+) True XLOC_021505
TCONS_00042736 lncRNA downstream 532939 11347436 ~ 11374684 (+) False XLOC_021506
TCONS_00042740 lncRNA downstream 1034251 11848748 ~ 11851894 (+) True XLOC_021507
TCONS_00044787 lncRNA downstream 1392934 12207431 ~ 12207959 (+) False XLOC_021513
TCONS_00044788 lncRNA downstream 1445039 12259536 ~ 12279048 (+) True XLOC_021514
TCONS_00042730 mRNA upstream 226773 10469955 ~ 10587257 (+) True XLOC_021502
TCONS_00042726 mRNA upstream 360953 10396842 ~ 10453077 (+) False XLOC_021501
TCONS_00042727 mRNA upstream 364581 10396889 ~ 10449449 (+) False XLOC_021501
TCONS_00042728 mRNA upstream 365025 10426219 ~ 10449005 (+) False XLOC_021501
TCONS_00042729 mRNA upstream 365342 10431776 ~ 10448688 (+) True XLOC_021501
TCONS_00042734 mRNA downstream 471165 11285662 ~ 11452312 (+) False XLOC_021506
TCONS_00042735 mRNA downstream 532816 11347313 ~ 11448747 (+) False XLOC_021506
TCONS_00042737 mRNA downstream 559671 11374168 ~ 11448740 (+) True XLOC_021506
TCONS_00042738 mRNA downstream 854612 11669109 ~ 11861393 (+) False XLOC_021507
TCONS_00042739 mRNA downstream 854840 11669337 ~ 11859349 (+) False XLOC_021507
TCONS_00042731 other upstream 207484 10601324 ~ 10606546 (+) True XLOC_021503
TCONS_00042724 other upstream 462457 10350891 ~ 10351573 (+) True XLOC_021499
TCONS_00042723 other upstream 463601 10347877 ~ 10350429 (+) False XLOC_021499
TCONS_00042720 other upstream 655129 10146552 ~ 10158901 (+) False XLOC_021498
TCONS_00042717 other upstream 1086598 9727410 ~ 9727432 (+) True XLOC_021494
TCONS_00042741 other downstream 1121087 11935584 ~ 11935700 (+) True XLOC_021508
TCONS_00042743 other downstream 1269060 12083557 ~ 12083671 (+) True XLOC_021510
TCONS_00042745 other downstream 1320342 12134839 ~ 12150667 (+) False XLOC_021511
TCONS_00042749 other downstream 1399470 12213967 ~ 12218375 (+) True XLOC_021513
TCONS_00042766 other downstream 2628111 13442608 ~ 13442722 (+) True XLOC_021525

Expression Profile


//