RNA id: TU1363354



Basic Information


Item Value
RNA id TU1363354
length 301
lncRNA type intronic
GC content 0.62
exon number 1
gene id G1194931
representative True

Chromosome Information


Item Value
chromosome id NC_048577.1
NCBI id CM023231.2
chromosome length 73332040
location 63120517 ~ 63120817 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctggggacaccgtgcgctccacagcataacacggtgcctgcccggtctctctagcccaccggtaaccacaggaagttggctcaggtctcctacctggcgtagccatactccctgttagccccccccccaagaaatttttggggctgactcccgggcttccatccacgacgccgcgctgcctcctcataccagcgcctctccgctttcgccgcctcccgttcttccttggggcggcgatactctcctggctgagcccaaggtcctttaccgtctaattcgtcctcccatgtccatacctcct

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1363352 lncRNA downstream 17511 63102707 ~ 63103006 (-) True G1194929
TU1363351 lncRNA downstream 22370 63097926 ~ 63098147 (-) True G1194928
TU1363340 lncRNA downstream 52217 63067914 ~ 63068300 (-) True G1194918
TU1363326 lncRNA downstream 77597 63040323 ~ 63042920 (-) True G1194907
TU1363325 lncRNA downstream 81170 63037564 ~ 63039347 (-) True G1194906
TU1363357 lncRNA upstream 18008 63138825 ~ 63139634 (-) True G1194934
TU1363366 lncRNA upstream 48386 63169203 ~ 63169413 (-) True G1194943
TU1363368 lncRNA upstream 52157 63172974 ~ 63173185 (-) True G1194945
TU1363371 lncRNA upstream 56543 63177360 ~ 63177684 (-) True G1194948
TU1363372 lncRNA upstream 58297 63179114 ~ 63179366 (-) True G1194949
XM_021559074.2 mRNA downstream 163111 62937168 ~ 62957406 (-) True LOC110487151
XM_036941853.1 mRNA downstream 193598 62899607 ~ 62926919 (-) False LOC118938348
XM_036941838.1 mRNA downstream 608088 62506293 ~ 62512429 (-) True LOC110487064
XM_036941833.1 mRNA downstream 621327 62495039 ~ 62499190 (-) True LOC118938345
XM_036941835.1 mRNA downstream 646093 62470465 ~ 62474424 (-) False LOC118938346
XM_036941864.1 mRNA upstream 186364 63307181 ~ 63309138 (-) False LOC110517310
XM_021595432.2 mRNA upstream 186364 63307181 ~ 63309144 (-) True LOC110517310
XM_021559012.2 mRNA upstream 235668 63356485 ~ 63361782 (-) True LOC110487088
XM_036941867.1 mRNA upstream 248875 63369692 ~ 63399197 (-) False LOC110487424
XM_036941868.1 mRNA upstream 248876 63369693 ~ 63399196 (-) False LOC110487424
TU1363302 other downstream 38944 63072315 ~ 63081573 (-) True LOC110486089
TU1363300 other downstream 65156 63042006 ~ 63055361 (-) False LOC110486089
TU1363301 other downstream 65156 63042006 ~ 63055361 (-) False LOC110486089
TU1363034 other downstream 183444 62935786 ~ 62937073 (-) True G1194684
TU1363008 other downstream 193701 62900643 ~ 62926816 (-) True LOC118938348
TU1363356 other upstream 16223 63137040 ~ 63137722 (-) True G1194933
TU1363571 other upstream 376281 63497098 ~ 63505524 (-) True LOC110485277
TU1364247 other upstream 824259 63945076 ~ 63945764 (-) True G1195624
TU1364356 other upstream 1213876 64334693 ~ 64347407 (-) False LOC110487482
TU1364357 other upstream 1213876 64334693 ~ 64347407 (-) False LOC110487482

Expression Profile


TU1363354 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU1363354 Expression in each Bioproject

Bar chart with 20 bars.
TU1363354 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.