RNA id: TU1402443



Basic Information


Item Value
RNA id TU1402443
length 349
lncRNA type inter_gene
GC content 0.38
exon number 1
gene id G1228890
representative True

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 23582244 ~ 23582592 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GGGCGGCTGTCTGTGGAGGATTAGAGTTTAACAGATGTTGTAAACATGAAACTGTGTAATTCCGAACTTTATCCGCAACGTTATATTCCATTTGGTTAAACTGAAGCAATACCTCTGCCATGTACTTAATTGTAACATGGACAGCTCATTGTATTGTTTGAGGAATTGATTATTAGTTAGATATGCAACTCATGCACCAAATGGCAGTTATCACAATCCCCACATCAGGAATGATTCAGAACTTCCTCCCTGTGATTTACTTGTTCCTGCTTTGTAAAATACAGAAGTTCAATAGAACCTTCAATGTTATCTATGCATTTCCATTGGCAAAAGACATACAAGTATTGGC

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1402408 lncRNA upstream 48091 23533233 ~ 23534153 (+) True G1228860
TU1402380 lncRNA upstream 63776 23515067 ~ 23518468 (+) True G1228836
TU1402392 lncRNA upstream 81921 23499756 ~ 23500323 (+) False G1228847
TU1402393 lncRNA upstream 81921 23499804 ~ 23500323 (+) True G1228847
TU1402394 lncRNA upstream 83450 23498071 ~ 23498794 (+) True G1228848
TU1402446 lncRNA downstream 9719 23592311 ~ 23592535 (+) True G1228893
TU1402448 lncRNA downstream 11047 23593639 ~ 23593899 (+) True G1228895
TU1402450 lncRNA downstream 13325 23595917 ~ 23598010 (+) True G1228897
TU1402452 lncRNA downstream 25683 23608275 ~ 23608677 (+) True G1228899
TU1402453 lncRNA downstream 26165 23608757 ~ 23609342 (+) True G1228900
XR_005035956.1 mRNA upstream 8267 23572973 ~ 23573977 (+) True LOC118938707
XM_021561530.2 mRNA upstream 260587 23314948 ~ 23321657 (+) False ky
XM_021561529.2 mRNA upstream 260587 23314993 ~ 23321657 (+) True ky
XM_036943160.1 mRNA upstream 325875 22901758 ~ 23256369 (+) False LOC110487749
XM_036943159.1 mRNA upstream 325881 23154862 ~ 23256363 (+) True LOC110487749
XM_021561539.2 mRNA downstream 34121 23616713 ~ 23622863 (+) False shisa3
XM_021561544.2 mRNA downstream 242782 23825374 ~ 23830234 (+) True grxcr1a
XM_021561549.2 mRNA downstream 285976 23868568 ~ 23873598 (+) False LOC110489012
XM_036943169.1 mRNA downstream 287142 23869734 ~ 23873598 (+) True LOC110489012
XM_036943178.1 mRNA downstream 817891 24400483 ~ 24439204 (+) True LOC110489017
TU1401977 other upstream 728583 22853315 ~ 22853661 (+) True G1228466
TU1399161 other upstream 2886107 20695672 ~ 20696137 (+) True G1225840
TU1398501 other upstream 3268134 20308619 ~ 20314110 (+) True LOC110488973
TU1398416 other upstream 3569767 20012015 ~ 20012477 (+) True G1225174
TU1398415 other upstream 3570711 20011030 ~ 20011533 (+) True G1225173
TU1402466 other downstream 34131 23616723 ~ 23621248 (+) False shisa3
TU1402464 other downstream 34265 23616857 ~ 23621248 (+) False shisa3
TU1403926 other downstream 865708 24448300 ~ 24455897 (+) False LOC110489020
TU1403927 other downstream 865981 24448573 ~ 24455897 (+) False LOC110489020
TU1403929 other downstream 865981 24448573 ~ 24455897 (+) False LOC110489020

Expression Profile


TU1402443 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

TU1402443 Expression in each Bioproject

Bar chart with 9 bars.
TU1402443 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.