RNA id: TU1423134



Basic Information


Item Value
RNA id TU1423134
length 337
lncRNA type inter_gene
GC content 0.38
exon number 2
gene id G1246531
representative False

Chromosome Information


Item Value
chromosome id NC_048578.1
NCBI id CM023232.3
chromosome length 43310081
location 41377034 ~ 41379594 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACCGGGTATGGTAACTATACTGGTTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATACTGGGTATGGTAACTATAGTAGGTATGGTAACTATACTGGGTATGGTAACTATACTGG

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1423129 lncRNA downstream 373 41374443 ~ 41376661 (-) True G1246529
TU1423101 lncRNA downstream 36867 41339733 ~ 41340167 (-) True G1246515
TU1423095 lncRNA downstream 37344 41315617 ~ 41339690 (-) True G1246510
TU1423100 lncRNA downstream 47534 41329093 ~ 41329500 (-) True G1246514
TU1423093 lncRNA downstream 60282 41315140 ~ 41316752 (-) False G1246510
TU1423151 lncRNA upstream 19988 41397778 ~ 41398126 (-) True G1246540
TU1423154 lncRNA upstream 22005 41399795 ~ 41400130 (-) True G1246542
TU1423158 lncRNA upstream 24049 41401839 ~ 41402135 (-) True G1246546
TU1423170 lncRNA upstream 33601 41411391 ~ 41411632 (-) True G1246558
TU1423178 lncRNA upstream 37296 41415086 ~ 41415540 (-) True G1246566
XM_036943561.1 mRNA downstream 18159 41317663 ~ 41358875 (-) True LOC110487959
XM_036943649.1 mRNA downstream 324719 41050692 ~ 41052315 (-) True LOC118938767
XM_036943553.1 mRNA downstream 391332 40976712 ~ 40985702 (-) False LOC118938734
XM_036943554.1 mRNA downstream 406585 40950986 ~ 40970449 (-) False LOC110489236
XM_036943555.1 mRNA downstream 406894 40950986 ~ 40970140 (-) False LOC110489236
XM_021559894.2 mRNA upstream 171497 41549287 ~ 41551540 (-) False LOC110487966
XM_036943569.1 mRNA upstream 250608 41628398 ~ 41655448 (-) False LOC110487963
XM_036943568.1 mRNA upstream 250608 41628398 ~ 41655871 (-) False LOC110487963
XM_036943570.1 mRNA upstream 250608 41628398 ~ 41655871 (-) True LOC110487963
XM_036943572.1 mRNA upstream 302309 41680099 ~ 41709893 (-) False LOC110524910
TU1423126 other downstream 373 41372866 ~ 41376661 (-) False G1246529
TU1422689 other downstream 442467 40933172 ~ 40934567 (-) True G1246175
TU1422657 other downstream 504134 40863808 ~ 40872900 (-) True LOC110489235
TU1422515 other downstream 629456 40745525 ~ 40747578 (-) True G1246044
TU1422479 other downstream 707463 40668575 ~ 40669571 (-) False G1246021
TU1423509 other upstream 235337 41613127 ~ 41613833 (-) True G1246806
TU1423850 other upstream 732923 42110713 ~ 42111119 (-) True G1247036
TU1424115 other upstream 916737 42294527 ~ 42297572 (-) True G1247239
TU1424220 other upstream 995025 42372815 ~ 42409235 (-) False G1247271
TU1424218 other upstream 995999 42373789 ~ 42376035 (-) True G1247271

Expression Profile


TU1423134 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

TU1423134 Expression in each Bioproject

Bar chart with 3 bars.
TU1423134 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 250.
End of interactive chart.