RNA id: TU1431674



Basic Information


Item Value
RNA id TU1431674
length 219
RNA type TUCP
GC content 0.51
exon number 1
gene id G1253229
representative True

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 6407071 ~ 6407289 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


GATAGAGACCATGAAGGACCTGAAAGAGACCATGGAGGACCTGATAGAGACCATGGAGGACCTAATAGAGACCATGGAGGACCTGAAAGAGACCATGGATGACCTGATAGAGACCACGGAGAACCTGATAGAGACCATGGAGGACCTGATAGAGACCACGGAGAACCTGATAGAGACCATGGAGGACCTGATAGAGACCACGGAGAACCTGATAGAGAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1431673 lncRNA downstream 4338 6402027 ~ 6402733 (-) True G1253228
TU1431672 lncRNA downstream 5506 6401361 ~ 6401565 (-) True G1253227
TU1431671 lncRNA downstream 6856 6399851 ~ 6400215 (-) True G1253226
TU1431633 lncRNA downstream 18675 6387983 ~ 6388396 (-) True G1253207
TU1431618 lncRNA downstream 44672 6361856 ~ 6362399 (-) True G1253194
TU1431675 lncRNA upstream 384 6407673 ~ 6407995 (-) True G1253230
TU1431680 lncRNA upstream 13401 6420690 ~ 6421932 (-) False G1253232
TU1431681 lncRNA upstream 17907 6425196 ~ 6428719 (-) True G1253232
TU1431706 lncRNA upstream 33567 6440856 ~ 6441102 (-) True G1253254
TU1431717 lncRNA upstream 40093 6447382 ~ 6448213 (-) True G1253264
XM_036945684.1 mRNA downstream 212086 6193557 ~ 6194985 (-) True LOC110489534
XM_036945674.1 mRNA downstream 539549 5860705 ~ 5867522 (-) True LOC110490885
XM_036945597.1 mRNA downstream 1403410 4894083 ~ 5003661 (-) False LOC110490882
XM_036945671.1 mRNA downstream 1637728 4741680 ~ 4769343 (-) True LOC110490881
XM_036945596.1 mRNA downstream 1836895 4568529 ~ 4570176 (-) True LOC118938936
XM_036945686.1 mRNA upstream 380435 6787724 ~ 6804698 (-) False LOC110490887
LOC110490888 mRNA upstream 545679 6952968 ~ 6956509 (-) True LOC110490888
XR_005036347.1 mRNA upstream 557189 6964478 ~ 6966918 (-) True LOC118938955
XM_036945688.1 mRNA upstream 560198 6967487 ~ 6984245 (-) False LOC110489535
XM_036945687.1 mRNA upstream 560198 6967487 ~ 6997025 (-) True LOC110489535
TU1430304 other downstream 1510586 4895622 ~ 4896485 (-) True LOC110490882
TU1430278 other downstream 1567192 4839384 ~ 4839879 (-) True G1252027
TU1430191 other downstream 1618644 4782640 ~ 4788427 (-) False G1251965
TU1429418 other downstream 2430633 3939865 ~ 3976438 (-) True dipk2ab
TU1428507 other downstream 3419661 2987114 ~ 2987410 (-) True G1250592
TU1431731 other upstream 54913 6462202 ~ 6462560 (-) True G1253278
TU1432811 other upstream 918423 7325712 ~ 7326456 (-) True G1254214
TU1434531 other upstream 2616295 9023584 ~ 9024003 (-) True G1255735
TU1434982 other upstream 3070524 9477813 ~ 9478818 (-) True G1256146
TU1435537 other upstream 3466230 9873519 ~ 9874742 (-) True G1256654

Expression Profile


TU1431674 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.5.
End of interactive chart.

TU1431674 Expression in each Bioproject

Bar chart with 5 bars.
TU1431674 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 12.
End of interactive chart.