RNA id: TU1433547



Basic Information


Item Value
RNA id TU1433547
length 224
lncRNA type inter_gene
GC content 0.51
exon number 1
gene id G1254886
representative True

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 8149793 ~ 8150016 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aaggttcaccttccaacaggacaacgaccctaagcacacagcaaagacaacgcaggagtggcttcgggacaagtctctgaatgtccttgagtggcccagccagagcctggacttgaacccgatcgaacatctctggacagacctgaaaatagctgtgcagtgacgctcctcattcaacctgacagagcttgagaggatctgcagagaagaatggaagaaacttc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1433538 lncRNA upstream 37638 8111900 ~ 8112155 (+) True G1254877
TU1433525 lncRNA upstream 49813 8099762 ~ 8099980 (+) True G1254864
TU1433267 lncRNA upstream 54102 8095181 ~ 8095691 (+) True G1254637
TU1433268 lncRNA upstream 55439 8093757 ~ 8094354 (+) True LOC110490897
TU1433391 lncRNA upstream 70133 8079460 ~ 8079660 (+) True G1254751
TU1433551 lncRNA downstream 1170 8151186 ~ 8153429 (+) True G1254890
TU1433570 lncRNA downstream 18459 8168475 ~ 8168685 (+) True G1254906
TU1433562 lncRNA downstream 34702 8184718 ~ 8185844 (+) True G1254898
TU1433561 lncRNA downstream 40775 8190791 ~ 8214003 (+) True G1254897
TU1433581 lncRNA downstream 49895 8199911 ~ 8200214 (+) True G1254916
XM_036945701.1 mRNA upstream 55374 7899106 ~ 8094419 (+) False LOC110490897
XM_036945702.1 mRNA upstream 55374 7899106 ~ 8094419 (+) False LOC110490897
LOC110490896 mRNA upstream 283715 7863667 ~ 7866078 (+) True LOC110490896
XM_036945694.1 mRNA upstream 1010230 7110207 ~ 7139563 (+) False LOC110489541
XM_036945695.1 mRNA upstream 1010231 7110207 ~ 7139562 (+) False LOC110489541
XM_036945711.1 mRNA downstream 291643 8441659 ~ 8453058 (+) False LOC110489552
XM_036945707.1 mRNA downstream 292717 8442733 ~ 8453058 (+) False LOC110489552
XM_036945708.1 mRNA downstream 292717 8442733 ~ 8453058 (+) False LOC110489552
XM_036945710.1 mRNA downstream 292717 8442733 ~ 8453058 (+) False LOC110489552
XR_005036349.1 mRNA downstream 292717 8442733 ~ 8453058 (+) True LOC110489552
TU1432276 other upstream 1022170 7110276 ~ 7127623 (+) True LOC110489541
TU1432232 other upstream 1060758 7086331 ~ 7089035 (+) True G1253720
TU1432235 other upstream 1148380 6997791 ~ 7001413 (+) True alg14
TU1432213 other upstream 1181377 6964482 ~ 6968416 (+) False G1253703
TU1434364 other downstream 869229 9019245 ~ 9019731 (+) True G1255589
TU1434334 other downstream 907263 9057279 ~ 9061028 (+) False LOC110489557
TU1434335 other downstream 907263 9057279 ~ 9060925 (+) False LOC110489557
TU1434337 other downstream 907263 9057279 ~ 9060925 (+) True LOC110489557
TU1436547 other downstream 2984828 11134844 ~ 11135414 (+) True G1257500

Expression Profile


TU1433547 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 50.
End of interactive chart.

TU1433547 Expression in each Bioproject

Bar chart with 21 bars.
TU1433547 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1000.
End of interactive chart.