RNA id: TU1435062



Basic Information


Item Value
RNA id TU1435062
length 598
lncRNA type inter_gene
GC content 0.49
exon number 2
gene id G1256224
representative False

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 9555456 ~ 9556132 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


aacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggcggtcctcatgagagacagttaactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggcggtcctcatgagagccagttaactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggcggtcctcatgagagccagttaactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggcggtcctcatgagatccagtttcatcacagcagaggtaactctgggtcttcctttcctgtggtggtcctcatgagagacagttcactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggtggtcctcatgagagacagttaactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggtggtcctcatgagagacagttaactctaatgaacttatcctctgcagcagaggtaactctgggtcttcctttcctgtggtggtcctcatgaga

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1435014 lncRNA downstream 32460 9522792 ~ 9522996 (-) True G1256176
TU1435012 lncRNA downstream 33124 9520664 ~ 9522332 (-) True G1256174
TU1435010 lncRNA downstream 36076 9519096 ~ 9519380 (-) True G1256172
TU1434981 lncRNA downstream 80762 9474324 ~ 9474694 (-) True G1256145
TU1434871 lncRNA downstream 180185 9374124 ~ 9375271 (-) False G1256050
TU1435078 lncRNA upstream 8578 9564710 ~ 9565105 (-) True G1256237
TU1435089 lncRNA upstream 19706 9575838 ~ 9576055 (-) True G1256248
TU1435108 lncRNA upstream 35929 9592061 ~ 9592753 (-) True G1256267
TU1435376 lncRNA upstream 44400 9600532 ~ 9600985 (-) True G1256516
TU1435381 lncRNA upstream 51422 9607554 ~ 9607786 (-) True G1256521
XM_021562289.2 mRNA downstream 133433 9418351 ~ 9422023 (-) True LOC110489563
XM_036945570.1 mRNA downstream 591243 8963472 ~ 8964213 (-) True LOC110514162
XM_036945717.1 mRNA downstream 929262 8597494 ~ 8626194 (-) False LOC110489554
XM_036945718.1 mRNA downstream 929262 8597494 ~ 8626194 (-) True LOC110489554
XM_036945720.1 mRNA downstream 943310 8597494 ~ 8612146 (-) False LOC110489554
XM_021562297.2 mRNA upstream 664365 10220497 ~ 10246539 (-) False LOC110489568
XM_021562299.2 mRNA upstream 664365 10220497 ~ 10246539 (-) False LOC110489568
XM_021562296.2 mRNA upstream 664365 10220497 ~ 10246556 (-) False LOC110489568
XM_021562295.2 mRNA upstream 664365 10220497 ~ 10246560 (-) True LOC110489568
XM_036943685.1 mRNA upstream 700211 10256343 ~ 10296042 (-) False LOC110489570
TU1434982 other downstream 76638 9477813 ~ 9478818 (-) True G1256146
TU1434531 other downstream 531453 9023584 ~ 9024003 (-) True G1255735
TU1432811 other downstream 2229000 7325712 ~ 7326456 (-) True G1254214
TU1431731 other downstream 3092896 6462202 ~ 6462560 (-) True G1253278
TU1431674 other downstream 3148167 6407071 ~ 6407289 (-) True G1253229
TU1435537 other upstream 317387 9873519 ~ 9874742 (-) True G1256654
TU1435807 other upstream 731541 10287673 ~ 10295990 (-) True LOC110489570
TU1436701 other upstream 1262311 10818443 ~ 10818911 (-) True G1257642
TU1438430 other upstream 2954740 12510872 ~ 12533388 (-) False LOC110489593
TU1438431 other upstream 2955351 12511483 ~ 12533388 (-) True LOC110489593

Expression Profile


TU1435062 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

TU1435062 Expression in each Bioproject

Bar chart with 21 bars.
TU1435062 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.