RNA id: TU1463174



Basic Information


Item Value
RNA id TU1463174
length 403
RNA type TUCP
GC content 0.57
exon number 1
gene id G1281361
representative True

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 31864234 ~ 31864636 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gagtaatacctatgtgagaatgctgttcatcgactacagctcggcatttaacaccatagtgccctccaagctcgtcatcaagctcgagaccctgggtctcgaccccgccctgtgcaactgggtactggacttcctgacgggccgcccccaggtggtgagggtaggtaacaacatctccaccccgctgatcctcaacactggggccccacaagggtgcgttctgagccctctcctgtactccctgttcacccacaactgtgtggccacgcacgcctccaactcaatcatcaagtttgcggacgacacaacagtggtaggcttgattaccaacaacgacgagacggcctacagggaggaggtgagggccctcggagtgtggtgtcaggaaaataacctcacactc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1463011 lncRNA downstream 67032 31796958 ~ 31797202 (-) True G1281220
TU1463004 lncRNA downstream 71475 31792292 ~ 31792759 (-) True G1281213
TU1462996 lncRNA downstream 75311 31788666 ~ 31788923 (-) True G1281205
TU1462995 lncRNA downstream 75688 31788297 ~ 31788546 (-) True G1281204
TU1462974 lncRNA downstream 88474 31775558 ~ 31775760 (-) True G1281184
TU1463178 lncRNA upstream 3032 31867668 ~ 31867900 (-) True G1281365
TU1463161 lncRNA upstream 58850 31923486 ~ 31924463 (-) True G1281348
TU1463327 lncRNA upstream 85942 31950578 ~ 31951012 (-) True G1281508
TU1463328 lncRNA upstream 88267 31952903 ~ 31953114 (-) True G1281509
TU1463330 lncRNA upstream 91176 31955812 ~ 31956014 (-) True G1281511
XM_021563079.2 mRNA downstream 18222 31824422 ~ 31846012 (-) True dipk1c
XM_021563077.2 mRNA downstream 106075 31750154 ~ 31758159 (-) True LOC110490002
LOC110490955 mRNA downstream 235833 31616010 ~ 31628401 (-) True LOC110490955
XR_005036309.1 mRNA downstream 436062 31424841 ~ 31428172 (-) True LOC118938914
XM_036944296.1 mRNA downstream 467847 31368447 ~ 31396387 (-) False maf1b
XM_021563081.2 mRNA upstream 6878 31871514 ~ 31884515 (-) True tubb6
XM_021563082.2 mRNA upstream 22687 31887323 ~ 31901387 (-) True cidea
XR_005036084.1 mRNA upstream 153763 32018399 ~ 32032349 (-) False LOC110490834
XR_002468756.2 mRNA upstream 166874 32031510 ~ 32032349 (-) True LOC110490834
XM_021563087.2 mRNA upstream 256295 32120931 ~ 32286156 (-) False sugct
TU1460659 other downstream 1875718 29979175 ~ 29988516 (-) False dlgap1b
TU1460464 other downstream 2232466 29631025 ~ 29631768 (-) True G1278860
TU1459005 other downstream 3160681 28701202 ~ 28703553 (-) True LOC110489947
TU1458959 other downstream 3298721 28559311 ~ 28565513 (-) True adcyap1a
TU1458397 other downstream 3598479 28261540 ~ 28265755 (-) True G1276905
TU1463176 other upstream 653 31865289 ~ 31866137 (-) True G1281363
TU1464009 other upstream 611283 32475919 ~ 32478516 (-) False G1282159
TU1464010 other upstream 611283 32475919 ~ 32478488 (-) True G1282159
TU1465156 other upstream 1397944 33262580 ~ 33266218 (-) True G1283257
TU1467614 other upstream 3120217 34984853 ~ 34985274 (-) True G1285645

Expression Profile


TU1463174 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

TU1463174 Expression in each Bioproject

Bar chart with 20 bars.
TU1463174 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.