RNA id: TU1472886



Basic Information


Item Value
RNA id TU1472886
length 412
lncRNA type inter_gene
GC content 0.40
exon number 2
gene id G1290620
representative False

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 39188186 ~ 39279823 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


ctataggtacagattggtagccccgatttgaaatccgcccttttctatgaagagcagagaagcaggggaagattttagcttgcggaacttttttcctcaaaaatgctccgaaagtggtcaaaacgaccgttgtttgggaaggttgaaaaacacgtggtaatgcagttacaaaaacagctgtaccgtaagttccgtatggaatattttgattctgcacacagctatgaatagcagagaagtagacaaatatcccattcactctaacttcttgtctaacttgttgcagtattggtcaaaatagacactgcttgccaaaatgttacagaaactgatgttggtgctgttacttaaactcctgtaacttttgatgtgaatataatttttgcctccaaactccagatttgagtgacag

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1472908 lncRNA upstream 3919 39181236 ~ 39184267 (+) True G1290623
TU1472877 lncRNA upstream 21984 39136791 ~ 39166202 (+) True G1290619
TU1472865 lncRNA upstream 65113 39122681 ~ 39123073 (+) True G1290613
TU1472842 lncRNA upstream 99851 39086859 ~ 39088335 (+) False LOC110490841
TU1472910 lncRNA downstream 1743 39222557 ~ 39224019 (+) True G1290624
TU1472884 lncRNA downstream 11183 39231997 ~ 39238311 (+) False G1290620
TU1472888 lncRNA downstream 11183 39231997 ~ 39234498 (+) False G1290620
TU1472901 lncRNA downstream 11183 39231997 ~ 39233454 (+) False G1290620
TU1472903 lncRNA downstream 20289 39241103 ~ 39292547 (+) True G1290621
XM_036945535.1 mRNA upstream 98550 39088073 ~ 39089636 (+) False LOC110490841
XM_021564185.2 mRNA upstream 103486 39082814 ~ 39084700 (+) True LOC110490726
LOC110490723 mRNA upstream 332078 38855250 ~ 38856108 (+) True LOC110490723
XM_036944344.1 mRNA upstream 607430 38576635 ~ 38580756 (+) False LOC110490039
XM_021563144.2 mRNA downstream 326530 39547344 ~ 39589108 (+) False brca2
XM_021563147.2 mRNA downstream 335055 39555869 ~ 39589108 (+) False brca2
XM_021563152.2 mRNA downstream 335079 39555893 ~ 39589108 (+) False brca2
XM_021563145.2 mRNA downstream 335379 39556193 ~ 39589108 (+) False brca2
XM_021563148.2 mRNA downstream 335379 39556193 ~ 39589108 (+) False brca2
TU1472866 other upstream 61177 39126272 ~ 39127009 (+) True G1290614
TU1472790 other upstream 150527 39037005 ~ 39037659 (+) False G1290549
TU1471908 other upstream 587945 38594880 ~ 38600241 (+) False G1289710
TU1471909 other upstream 587945 38594880 ~ 38600241 (+) True G1289710
TU1471681 other upstream 1004183 38183436 ~ 38184003 (+) True G1289491
TU1473879 other downstream 846744 40067558 ~ 40067907 (+) True G1291464
TU1473916 other downstream 899455 40120269 ~ 40130734 (+) True LOC110490048
TU1475600 other downstream 2362559 41583373 ~ 41588144 (+) False G1293072
TU1475602 other downstream 2362559 41583373 ~ 41588087 (+) True G1293072
TU1475855 other downstream 2688220 41909034 ~ 41909611 (+) True G1293295

Expression Profile


TU1472886 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

TU1472886 Expression in each Bioproject

Bar chart with 3 bars.
TU1472886 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.