RNA id: TU1475602



Basic Information


Item Value
RNA id TU1475602
length 757
RNA type TUCP
GC content 0.41
exon number 3
gene id G1293072
representative True

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 41583216 ~ 41589030 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


TCTACTTTGTGTGTACGTAGACAAACTCTAGACACGCTGGCCGGTGGATGCAGATTTCACTGAAGAACCAATGGACCGGTCGAAAAGAAATCCAGGTGATGACAAGGTGGCAGTGGGACCATGGCTTTTGGCCTTATTCATCTTTGTCGTCTGCGGATCAGCAATCTTCCAGATCATTCAGAGCATTCGAATGGGAATGTAATATCAGGAGCCCTACCATCATCACCTGTTTCCAGCATTCCTCTACACATCAAGTGGTTTCATGGTGCTTCACAGGATCAAAGATGATCAACTACCATCCATTCCTTTTTTCCTATTTCTCTTTTCCCCTTTTTGGCATTGCCAAACGGGGAAAGCACACCCTTGTCATCTTTGCCTTACATAACTGAGAAAAAAGATTGGAGAATGATTGAAGGATTTTGTTTCAGGGAACTACATGGGTATTTGTACAGTGATGACTGCTGTATGTGTCGATTGATGTGCCAAAACCAAATGGGAGTGAATTTCTGATATTCTCCTGTGGTATAAATTCCAGAACACAAGACCACAGTGACTTAATTCTAGAACTAAACTCTTAACTCTTCTTGGTTGTACACGGACAGTATCTGGTGTCTTATGGCCTTCACATTATAATGAATATTATGTGATGCCTTTTTCGTATTTCCAGTCATTTCTTCAGTCAACGAAACTAAATGGTCTTTTGAATCAGAAGATTTTTGCTAAGACAATGACATTCACTATTTCTGCCTAAACAAAC

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1475614 lncRNA upstream 5157 41577829 ~ 41578216 (+) True G1293084
TU1475580 lncRNA upstream 29425 41553534 ~ 41553948 (+) True G1293056
TU1475568 lncRNA upstream 37751 41544898 ~ 41545622 (+) True G1293045
TU1475554 lncRNA upstream 49547 41533280 ~ 41533826 (+) True trnap-cgg-205
TU1475550 lncRNA upstream 53546 41529167 ~ 41529827 (+) True G1293027
TU1475620 lncRNA downstream 3931 41592018 ~ 41592641 (+) True G1293089
TU1475609 lncRNA downstream 22046 41610133 ~ 41610840 (+) True G1293079
TU1475604 lncRNA downstream 36974 41625061 ~ 41626045 (+) True G1293074
TU1475607 lncRNA downstream 38035 41626122 ~ 41626379 (+) True G1293077
TU1475707 lncRNA downstream 145389 41733476 ~ 41735494 (+) True G1293169
XM_021563213.2 mRNA upstream 15522 41557648 ~ 41567851 (+) False LOC110490071
XM_021563212.2 mRNA upstream 15522 41557666 ~ 41567851 (+) True LOC110490071
trnap-cgg-207 mRNA upstream 45878 41537424 ~ 41537495 (+) True trnap-cgg-207
trnap-cgg-206 mRNA upstream 47681 41535621 ~ 41535692 (+) True trnap-cgg-206
trnap-cgg-205 mRNA upstream 49532 41533770 ~ 41533841 (+) False trnap-cgg-205
XM_036945536.1 mRNA downstream 376 41588463 ~ 41625040 (+) True LOC110490072
XM_021563226.2 mRNA downstream 222156 41810243 ~ 41836130 (+) False iqcg
XM_021563224.2 mRNA downstream 222169 41810256 ~ 41836130 (+) False iqcg
XM_021563223.2 mRNA downstream 222179 41810266 ~ 41836130 (+) True iqcg
XM_021563229.2 mRNA downstream 337087 41925174 ~ 41951832 (+) True LOC110490081
TU1473916 other upstream 1452639 40120269 ~ 40130734 (+) True LOC110490048
TU1473879 other upstream 1515466 40067558 ~ 40067907 (+) True G1291464
TU1472866 other upstream 2456364 39126272 ~ 39127009 (+) True G1290614
TU1472790 other upstream 2545714 39037005 ~ 39037659 (+) False G1290549
TU1471909 other upstream 2983132 38594880 ~ 38600241 (+) True G1289710
TU1475855 other downstream 320947 41909034 ~ 41909611 (+) True G1293295
TU1476968 other downstream 1176766 42764853 ~ 42767937 (+) True G1294319
TU1478092 other downstream 2008837 43596924 ~ 43597464 (+) True G1295348
TU1478516 other downstream 2328091 43916178 ~ 43916479 (+) True G1295730
TU1478633 other downstream 2441349 44029436 ~ 44029861 (+) True G1295845

Expression Profile


TU1475602 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

TU1475602 Expression in each Bioproject

Bar chart with 20 bars.
TU1475602 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.