RNA id: TU1517810



Basic Information


Item Value
RNA id TU1517810
length 622
lncRNA type inter_gene
GC content 0.33
exon number 4
gene id G1328596
representative False

Chromosome Information


Item Value
chromosome id NC_048579.1
NCBI id CM023233.2
chromosome length 81569517
location 78631542 ~ 78632729 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtgcacctggtgatctgaaatgtgcacctggtgacctgaaatgtgcacctggtgatctaaaatatgcaactggtaaccccaaaaaaaaaatttgggatgtttttttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgttttaatgggcaggtaccatcacgaatttgtcatgctcaaaatttgttagatgtatttttttttgtttccttactttttcaaagtcactgtgcatttggaatatgttttaatgggcaggtaccatcacgaatttgtcatgctcaaaattcaagctttactttgctcaaactatacctttgtcatcttgtgatctaaaatatgcaactggttacccaaaaaatttgttgatgtttttttgtttatgtttccttactttttcaaagtcactgtgcatttgcaatatgtttcaatgggcaggtaccatcacgaatttgtcatgctcaaaattcaagctttactttgctcaaactatacctttgtcatcttgtgatctaaaatatgcaactggttacctaaaacatttgttgatgtttttttgtttgtttccttactttttcaaagtcactgtgcatttgcaatatgttttaa

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1517796 lncRNA upstream 16515 78614189 ~ 78615027 (+) True G1328583
TU1517772 lncRNA upstream 44799 78565910 ~ 78586743 (+) True G1328561
TU1517758 lncRNA upstream 58032 78571404 ~ 78573510 (+) True G1328548
TU1517753 lncRNA upstream 106645 78524652 ~ 78524897 (+) True G1328546
TU1517721 lncRNA upstream 112631 78470353 ~ 78518911 (+) True G1328524
TU1517815 lncRNA downstream 4094 78636823 ~ 78678612 (+) True G1328598
TU1517849 lncRNA downstream 67054 78699783 ~ 78742133 (+) False G1328632
TU1517850 lncRNA downstream 67054 78699783 ~ 78742133 (+) False G1328632
TU1517851 lncRNA downstream 67054 78699783 ~ 78745994 (+) False G1328632
TU1517852 lncRNA downstream 93971 78726700 ~ 78745994 (+) True G1328632
XM_036945445.1 mRNA upstream 85382 78525988 ~ 78546160 (+) False LOC110507940
XM_036945446.1 mRNA upstream 85382 78526013 ~ 78546160 (+) True LOC110507940
trnaa-ugc-124 mRNA upstream 99002 78532470 ~ 78532540 (+) True trnaa-ugc-124
XM_036945440.1 mRNA upstream 115032 78471598 ~ 78516510 (+) False LOC118938868
XM_036945456.1 mRNA downstream 16845 78649574 ~ 78658219 (+) False LOC110510817
XM_036945454.1 mRNA downstream 16846 78649575 ~ 78658219 (+) False LOC110510817
XM_036945455.1 mRNA downstream 16847 78649576 ~ 78658219 (+) False LOC110510817
XM_036945452.1 mRNA downstream 17175 78649904 ~ 78658219 (+) True LOC110510817
XM_036945465.1 mRNA downstream 116601 78749330 ~ 78763876 (+) False LOC118936267
TU1517192 other upstream 561139 78070029 ~ 78070403 (+) True G1328201
TU1517133 other upstream 613731 77959066 ~ 78017811 (+) False LOC110490691
TU1517137 other upstream 649869 77959066 ~ 77981673 (+) True LOC110490691
TU1516094 other upstream 1818254 76809860 ~ 76813288 (+) True G1327379
TU1515923 other upstream 2041657 76587574 ~ 76589885 (+) False G1327230
TU1518030 other downstream 116649 78749378 ~ 78763940 (+) False LOC118936267
TU1518031 other downstream 116649 78749378 ~ 78763940 (+) False LOC118936267
TU1518032 other downstream 116649 78749378 ~ 78763940 (+) False LOC118936267
TU1518033 other downstream 116649 78749378 ~ 78763940 (+) False LOC118936267
TU1518034 other downstream 116649 78749378 ~ 78763940 (+) False LOC118936267

Expression Profile


TU1517810 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

TU1517810 Expression in each Bioproject

Bar chart with 15 bars.
TU1517810 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 125.
End of interactive chart.