RNA id: trnan-guu-13



Basic Information


Item Value
RNA id trnan-guu-13
length 74
RNA type mRNA
GC content 0.53
exon number 1
gene id trnan-guu-13
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 78421978 ~ 78422051 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


gtctctgtggcgcaattggttagcgcgttagactgttaatctaaaggttggtggttcgagcccacccagggacg

Function


GO: NA

KEGG: NA

JBrowse2


Neighbor


RNA id RNA type direction distance location representative gene id
TU1613770 lncRNA downstream 60677 78357403 ~ 78361301 (-) True G1412145
TU1613771 lncRNA downstream 63077 78358500 ~ 78358901 (-) True G1412146
TU1613731 lncRNA downstream 147901 78273455 ~ 78274077 (-) True G1412115
TU1613726 lncRNA downstream 157573 78263982 ~ 78264405 (-) True G1412110
TU1613716 lncRNA downstream 174580 78246162 ~ 78247398 (-) True G1412102
TU1613808 lncRNA upstream 30292 78452343 ~ 78453268 (-) True G1412169
TU1613811 lncRNA upstream 31421 78453472 ~ 78454261 (-) True fkbpl
TU1613833 lncRNA upstream 34393 78456444 ~ 78456887 (-) True G1412193
TU1613842 lncRNA upstream 61426 78483477 ~ 78483683 (-) True G1412200
TU1613844 lncRNA upstream 64710 78486761 ~ 78486961 (-) True G1412202
trnae-uuc-7 mRNA downstream 3089 78418818 ~ 78418889 (-) True trnae-uuc-7
XM_021567181.2 mRNA downstream 7308 78404170 ~ 78414670 (-) True ccdc115
XM_036947863.1 mRNA downstream 40392 78324077 ~ 78381586 (-) True LOC110492722
XM_036947862.1 mRNA downstream 107030 78206139 ~ 78314948 (-) True LOC110492720
XR_002469070.2 mRNA downstream 218210 78201885 ~ 78203768 (-) True LOC110492727
XM_036947864.1 mRNA upstream 19580 78441631 ~ 78450333 (-) False fkbpl
XM_021567182.2 mRNA upstream 19580 78441631 ~ 78454461 (-) False fkbpl
TU1613704 other downstream 102980 78316317 ~ 78318998 (-) False G1412091
TU1613705 other downstream 102980 78316317 ~ 78318998 (-) True G1412091
TU1613385 other downstream 354468 78066037 ~ 78067510 (-) False G1411845
TU1613851 other upstream 82240 78504291 ~ 78511632 (-) False G1412203

Expression Profile


trnan-guu-13 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

trnan-guu-13 Expression in each Bioproject

Bar chart with 1 bar.
trnan-guu-13 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 0.2.
End of interactive chart.