RNA id: TU1556224



Basic Information


Item Value
RNA id TU1556224
length 316
RNA type TUCP
GC content 0.47
exon number 1
gene id G1361671
representative True

Chromosome Information


Item Value
chromosome id NC_048580.1
NCBI id CM023234.2
chromosome length 78541548
location 29943441 ~ 29943756 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome
species rainbow trout
(Oncorhynchus mykiss)

Sequence


atcgaacagcccccgtgatatgcagctgttcagggaagctagaaaccattatacacaggcagttagaaaagccaaggctagctttttcatgcagaaatttgcttcctgcaacactaactcaaaaaagttctgggacactgtaaagtccatggagaataagaacccctcctcccagctgcccactgcactgaagataggaaacactgtcaccactgataaatccaccataattgagaatttaaataagcatttttctacggctggccatgctttccacctggctactcctaccccggtcaacagcactgcacccccc

Function


GO: NA

KEGG: NA

JBrowse2


Loading

Neighbor


RNA id RNA type direction distance location representative gene id
TU1556220 lncRNA upstream 1753 29941123 ~ 29941688 (+) True G1361667
TU1556136 lncRNA upstream 3064 29940154 ~ 29940377 (+) True G1361592
TU1556071 lncRNA upstream 110266 29832960 ~ 29833175 (+) True G1361529
TU1556066 lncRNA upstream 114645 29828570 ~ 29828796 (+) True G1361524
TU1556059 lncRNA upstream 117723 29825513 ~ 29825718 (+) True G1361517
TU1556239 lncRNA downstream 10754 29954510 ~ 29954952 (+) True G1361684
TU1556240 lncRNA downstream 11823 29955579 ~ 29956671 (+) True G1361685
TU1556242 lncRNA downstream 13680 29957436 ~ 29957661 (+) True G1361687
TU1556244 lncRNA downstream 14693 29958449 ~ 29958664 (+) True G1361689
TU1556246 lncRNA downstream 15701 29959457 ~ 29959681 (+) True G1361691
XM_021565566.2 mRNA upstream 18277 29907292 ~ 29925164 (+) True LOC110491801
XM_021565565.2 mRNA upstream 164300 29776440 ~ 29779141 (+) True LOC110491800
XM_021565564.2 mRNA upstream 216122 29714278 ~ 29727319 (+) True LOC110491799
XM_021565561.2 mRNA upstream 314430 29534042 ~ 29629011 (+) True LOC110491797
XR_005036502.1 mRNA upstream 326413 29534042 ~ 29617028 (+) False LOC110491797
XM_021565567.2 mRNA downstream 198673 30142429 ~ 30144341 (+) True LOC110491802
XM_036945881.1 mRNA downstream 655638 30599394 ~ 30658325 (+) True LOC110491805
LOC110492869 mRNA downstream 757243 30700999 ~ 30704172 (+) False LOC110492869
XR_002469090.2 mRNA downstream 764267 30708023 ~ 30708936 (+) True LOC110492895
XR_002468906.2 mRNA downstream 1073819 31017575 ~ 31074748 (+) False LOC110491812
TU1555703 other upstream 139073 29802654 ~ 29804368 (+) True G1361207
TU1552979 other upstream 1896051 28046682 ~ 28047390 (+) True G1358698
TU1552849 other upstream 1997600 27903050 ~ 27945841 (+) False LOC110491776
TU1552634 other upstream 2366349 27561147 ~ 27577092 (+) True LOC110491768
TU1552517 other upstream 2611166 27329311 ~ 27332275 (+) True G1358292
TU1557278 other downstream 759891 30703647 ~ 30704108 (+) True LOC110492869
TU1557509 other downstream 1010853 30954609 ~ 30955975 (+) True G1362902
TU1558037 other downstream 1290737 31234493 ~ 31235386 (+) True G1363401
TU1559558 other downstream 2457678 32401434 ~ 32401808 (+) True G1364768
TU1559704 other downstream 2663034 32606790 ~ 32607133 (+) True G1364907

Expression Profile


TU1556224 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

TU1556224 Expression in each Bioproject

Bar chart with 19 bars.
TU1556224 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.